Labshake search
Citations for GenScript :
201 - 250 of 536 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 10 amino acid sequences covering the four reported binding sites on the clathrin terminal domain (see Fig. 7A) were synthesized by GenScript (Piscataway, NJ) with > 95% purity ...
-
bioRxiv - Bioengineering 2019Quote: ... transferred onto PVDF membranes and probed with primary antibodies raised in rabbit against a synthetic PmHAS peptide (NDNDLKSMNVKGAS, amino acids 860 to 874, prepared by GenScript, Hong Kong) and/or a monoclonal mouse anti-FLAG M2 antibody (F3165 ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Ub-MCQ (Ub variant with an additional amino acid Cys between Met1 and Gln2) were constructed and cloned to the vector pET-22b by GenScript (Nanjing, China). The plasmids containing S ...
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Molecular Biology 2021Quote: Human langerin CRD WT and all mutants (amino acids 193-328) were cloned from a codon-optimized langerin gene for bacterial expression (GenScript, Piscataway, NJ, USA) into a pET-28a vector (GenScript ...
-
bioRxiv - Biophysics 2022Quote: DNA fragments coding the C-terminal 350 amino acids of E6AP were synthesized as a codon-optimized artificial gene (GenScript, Piscataway, NJ, USA). The products were subsequently ligated into the pET28a vector with NdeI and BamHI restriction enzymes and designated E6APHECT_WT ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultures were blocked by addition of 5 μg/ml of α factor (GenScript) every 90 min in YPAD until <10% cells were budded ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of a synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), eBioscience Cell Stimulation Cocktail (Fisher Scientific 00-4975-93 ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... CENP-T was fluorescently labeled with a GGGGK-TMR (5-Carboxytetramethylrhodamine) peptide (GenScript) using the Calcium-independent Sortase 7M (Hirakawa et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the samples were boiled in 5 х Loading Buffer (GenScript, Piscataway, NJ, USA) and subjected to SDS-PAGE or immunoblotting with indicated antibody.
-
bioRxiv - Biochemistry 2023Quote: ... The gene encoding for the GAF2 domain from All1280 of Nostoc PCC 7120 (NCBI protein ID BAB73237.1, UniProtKB Q8YXD3, amino acids 562-727) was ordered from Genscript (codon optimized for E. coli) in the pUC18 cloning vector ...
-
bioRxiv - Biochemistry 2019Quote: ... The 5’UTR of TV1 was amplified from a DNA fragment purchased from Genscript. Each TV was amplified using primers that contain restriction enzyme sites for NheI and cloned into the psiCHECK-2 vector ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Systems Biology 2019Quote: ... half of the cells were stimulated with erythropoietin (2 ng/mL; GenScript) 24 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...