Labshake search
Citations for GenScript :
201 - 250 of 589 citations for 8 2 4 difluorophenyl 8 oxooctanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2023Quote: ... A SARS-Cov-2 neutralizing monoclonal antibody (GenScript #A02057) was used as a positive control at a starting concentration of 3.2 ng/µL ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyclonal antibody used to purify γ-TuRC from Xenopus egg extract was generated against a purified γ-tubulin peptide (amino acids 412-451) through a commercial vendor (Genscript). The presence of γ-TuRC during its purification was tracked via Western blotting using the GTU88 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Evolutionary Biology 2020Quote: The gene encoding 4-hydroxybutyryl-CoA dehydratase (4HBD; Nmar_207) was purchased from Genscript Biotech (codon-optimized with cleavable N-terminal hexa-Histidine tag) ...
-
bioRxiv - Biochemistry 2020Quote: ... SDS-PAGE analysis was performed on precast 4-20% gradient gels (GenScript, USA) in a Tris-MOPS buffered system under reducing conditions according to manufacturer guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were separated on a 4-12% ExpressPlus™ PAGE gel (GenScript #M41212) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The extracts were fractionated on a 4-20% ExpressPlus™ PAGE gel (Genscript) using SDS-MOPS buffer and transferred onto nitrocellulose membrane (BioTrace™ NT Nitrocellulose transfer membrane ...
-
bioRxiv - Biochemistry 2023Quote: ... The pre-cast gradient gels (4-20 %) were purchased from GenScript (Piscataway, NJ). Electrophoresis was performed using a Bio-Rad SDS-PAGE gel analysis casting system (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Cell Biology 2020Quote: ... Trp68 rabbit polyclonal antibodies were custom generated and affinity purified against the TDP-43 amino acid sequence 65DAGWGNL71 by GenScript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2021Quote: ... elephas VTG amino acid sequence deduced in silico (Fig. 1A) was used to create two synthetic peptides (Fig 1B) (Genscript USA Inc.) to be employed for the production of specific anti-VTG antibodies (Twin Helix ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 10 amino acid sequences covering the four reported binding sites on the clathrin terminal domain (see Fig. 7A) were synthesized by GenScript (Piscataway, NJ) with > 95% purity ...
-
bioRxiv - Bioengineering 2019Quote: ... transferred onto PVDF membranes and probed with primary antibodies raised in rabbit against a synthetic PmHAS peptide (NDNDLKSMNVKGAS, amino acids 860 to 874, prepared by GenScript, Hong Kong) and/or a monoclonal mouse anti-FLAG M2 antibody (F3165 ...
-
bioRxiv - Immunology 2021Quote: ... resuspended at a density of 15 million/mL in complete RPMI and 100 μL of cell suspension containing 1.5 million cells was added to each well of a 96-well round-bottomed tissue culture plate and stimulated ex vivo with a peptide pool consisting of 15mer peptides overlapping by 11 amino acids spanning the S protein (GenScript, Piscataway, NJ), at a concentration of 1.2 μg/mL of each peptide in the presence of 1 μg/mL anti-CD28 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Ub-MCQ (Ub variant with an additional amino acid Cys between Met1 and Gln2) were constructed and cloned to the vector pET-22b by GenScript (Nanjing, China). The plasmids containing S ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was directly loaded on the 4-20% SDS-PAGE gel (GenScript) following addition of 4× laemmli loading buffer ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2022Quote: ... Whole worm lysates were then separated on 4-12% polyacrylamide gradient gels (GenScript, #M00654), transferred to membranes ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were visualized by SDS-PAGE (4-20% gradient gel, Sure Page Gels, GenScript), and band intensity was determined using Image Lab (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Molecular Biology 2021Quote: Human langerin CRD WT and all mutants (amino acids 193-328) were cloned from a codon-optimized langerin gene for bacterial expression (GenScript, Piscataway, NJ, USA) into a pET-28a vector (GenScript ...
-
bioRxiv - Biophysics 2022Quote: DNA fragments coding the C-terminal 350 amino acids of E6AP were synthesized as a codon-optimized artificial gene (GenScript, Piscataway, NJ, USA). The products were subsequently ligated into the pET28a vector with NdeI and BamHI restriction enzymes and designated E6APHECT_WT ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...