Labshake search
Citations for GenScript :
1 - 50 of 1003 citations for 7 Oxabicyclo 4.1.0 hepta 2 4 diene 1 3 4 trifluoro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Microbiology 2023Quote: ... phage 1/4 Gad1 was used and synthesized by Genscript. Gad1 and related homologs were cloned into the pSG-thrC-Phspank vector40 and transformed to DH5α competent cells ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Microbiology 2020Quote: ... Fragment 4 was ordered as synthetic sequence (GenScript) with the first 274 bp recodonised and was amplified from plasmid pUC57-re-ap2-hc-1 using primers ap2-hc-5'_HR2_re_F and ap2-hc-5'_HR2_re_R.
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Developmental Biology 2023Quote: ... then 4 × LDS sample buffer (GenScript, M00676-10) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Cell Biology 2019Quote: ... 10 ng/ml of IL-4 (Genscript, Piscataway, NJ) was applied to cultures until the respective time points ...
-
bioRxiv - Physiology 2022Quote: ... PAR-4 Agonist peptide (RP11529) was purchased from GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant Hsc70-4 protein was produced by GenScript by expression of the recombinant protein with a 6X His tag in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Plant Biology 2020Quote: ... coli (Supplementary Table 4) and synthesized by GenScript (Piscataway, NJ). The Arabidopsis THI4 sequence was the native cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Microbiology 2022Quote: SDS-PAGE analyses were performed using 4-12% SurePAGE (Genscript), the precast mini polyacrylamide gels ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... Interleukin-4 (catalog #Z02996) was purchased from GenScript (Piscataway, NJ). Reduced glutathione (catalog #G6529 ...
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Cell Biology 2023Quote: ... were separated via SDS-PAGE using 4- 12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Cancer Biology 2024Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... and resolved on a 4-12% Bis-Tris polyacrylamide gradient gel (Genscript). Proteins were transferred to PVDF membranes and immunodetection of respiratory chain complexes was performed using the Total OXPHOS Blue Native WB Antibody Cocktail (Abcam ...