Labshake search
Citations for GenScript :
301 - 350 of 496 citations for 7 Decyn 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... or 1-10 μg of Spike RBD protein (Sino Biological, Cat: 40592-V08H or GenScript, Cat: Z03483). “Mock” groups received PBS alone ...
-
bioRxiv - Biochemistry 2023Quote: MCM genes were synthesised and cloned into the ampicillin resistant pONT vector by GenScript (Supplementary Table 1). Genes were positioned downstream of a T7 promoter and N-terminally His-10 tagged ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 500 ng/mL RBD or 1 μg/mL NP (GenScript, Piscataway, New Jersey), and heat-inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Biochemistry 2023Quote: ... The cDNA of human STK25 isoform 1 (RefSeq accession no. NM_001271977.2) was cloned into the pcDNA3.1+ vector (GenScript). The Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Microbiology 2024Quote: ... The novel oriTs and relaxase operons were synthesized de novo and cloned into pCOLADuetTM-1 by GenScript USA Inc ...
-
bioRxiv - Bioengineering 2019Quote: ... The membrane was hybridized with a custom antibody at a 1 µg/mL dilution (GenScript, Item number: U3233DA170_2) to directly recognize the 1c19 scFv peptide (26.3KDa ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was eluted using 20 column columns purification buffer supplemented with 1 μM DYKDDDDK FLAG peptide (Genscript). Affinity purification of the TSEN-STREP construct was carried out using the STREP tag carried by the TSEN2 subunit ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell adhesion was enabled in all hydrogel groups through incorporation of either 1 mM RGD peptide (GCGYGRGDSPG, Genscript) or 2 μM thiolated Fn fragments (Fn9*10 or Fn4G) ...
-
bioRxiv - Developmental Biology 2022Quote: ... the samples were incubated for 1 hr at RT with horseradish peroxidase-conjugated anti-rabbit IgG (GenScript, A00098) or anti-mouse IgG (Pronteintech ...
-
bioRxiv - Biophysics 2019Quote: ... The protein was eluted with lysis buffer added 0.05% GDN and 300 μg ml-1 Flag peptide (Genscript). The protein solution was concentrated with a 100-kDa cut-off centricon (Milipore ...
-
bioRxiv - Biochemistry 2019Quote: The cDNA for Rab8a (residues 1-181, Q67L) lacking the flexible C-terminal tail was ordered from Genscript in a codon-optimized form to enable E.coli expression ...
-
bioRxiv - Microbiology 2021Quote: ... The left and right homology donor templates and the P4::gRNA constructs (Table 1) were synthesized by GenScript and inserted into the NheI and PvuII sites of pTMS001 generating pTMS007 and pTMS008 ...
-
bioRxiv - Immunology 2020Quote: Renilla luciferease fusion protein constructs were synthesized for the Fel d 1 component of cat allergen by GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... and the DABCYLGlu-EDANS labelled peptides encompassing the different cleavage sites (SI Table 1) were purchased from Genscript. Reactions were performed at room temperature in black 384-well polystyrene low volume plates (CELLSTAR-Greiner Bio-One # 784476 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA encoding TeNT-LC-HN (residues 1-870) and TeNT-HC were synthesized by GenScript (Piscataway, NJ). A thrombin protease cleavage site was inserted between I448 and A457 in both TeNT-LC-HN and chTeNT-LC-HN ...
-
bioRxiv - Cell Biology 2023Quote: ... The pGEX-6P-1-GST-OSBP(377-807) and pET28(+)-ORP2(49-480) plasmids were purchased from Genscript. The pET22b_His6_STARD1(66-284 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were subsequently washed with PBS and stained with α-camelid VHH antibodies (1:100, clone 96A3F5, Genscript) in 200 µl Cell Staining buffer for 30 min at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Cell Biology 2023Quote: ... coli were generated through custom synthesis and subcloned into an expression backbone (pETDuet-1) by Genscript (Piscataway, USA), as has been previously reported110.
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then pulsed with 20μg/ml OVA323–339 peptide (GenScript, Piscataway, NJ, Cat. No. RP10610-1) for 2 hours at 37℃ and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Biochemistry 2024Quote: ... SWR1C was eluted by nutating resin in 1 mL B-0.1 with 0.5 mg/mL recombinant 3xFlag peptide (Genscript) for 1 hour twice in series ...
-
bioRxiv - Cell Biology 2019Quote: ... pVB644OB: The full-length cDNA of wrb-1 was synthesized as a KpnI/KpnI fragment (GenScript Inc., NJ, USA) and cloned 3’ to ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Evolutionary Biology 2020Quote: ... the primers g11S/g11AS covering target site sequence 11 (Figure 1A; Supplementary table 1) were synthesized by Genscript (www.genscript.com.cn) and combined by annealing ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used in the study were mouse anti-FLAG (1:1000; Cat. No. A00187-200, Genscript, NJ, USA), chicken anti-GFP (1:2000 ...
-
bioRxiv - Biochemistry 2021Quote: 1 µg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized fom Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Biochemistry 2022Quote: The genes of the human AC isoforms 1 – 9 cloned into the expression plasmid pcDNA3.1+/C-(K)-DYK were purchased from GenScript and contained a C-terminal flag-tag ...
-
bioRxiv - Microbiology 2022Quote: ... The protein was then eluted with 1 CV of FLAG resin buffer supplemented with 0.2 mg/mL FLAG peptide (Genscript) after incubating with the elution buffer for 5 min on ice ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting supernatant was then loaded onto a gravity column with 1 mL α-FLAG G1 affinity resin (Genscript), and the flow through was passed through the column four more times ...
-
bioRxiv - Molecular Biology 2022Quote: ... a complete codon-optimized Omicron variant BA.1 spike was synthesized and inserted into pcDNA3.1 expression vector by Genscript. The clone includes the following amino acid differences from the Wuhan strain ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA fragment encoding human ACE2 (1-615) with a 6xHis tag at C terminus was synthesized by Genscript and cloned to the vector pCMV-IRES-puro ...
-
bioRxiv - Biochemistry 2021Quote: ... at 25 °C. The peptides except for the H3.3 (a.a. 1–59) peptide were all purchased from GenScript (Nanjing). The H3.3 (a.a ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Immunology 2021Quote: ... 1 μg/ml biotinylated stem peptide (15- or 16-residue long stem peptide-PEG6-Lys-Biotin synthesized from Genscript) was loaded on SA biosensors to a threshold of 0.5 nm ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was collected and incubated for 1 h with 2 ml of 50% slurry of Glutathione Resin (Genscript) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2020Quote: ... or a SARS-CoV (amino acid residues 1 to 1193) (GenBank: AAS00003.1) were synthesized using -optimized codons for Cricetulus griseus (CHO Cell) by GenScript. The cDNAs were subcloned into pTRIMER expression vector (GenHunter ...
-
bioRxiv - Biochemistry 2020Quote: Western blot analyses of protein samples were performed as described previously for rabbit anti-Tse1 (diluted 1:5,000; Genscript), rabbit anti-FLAG (diluted 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: The human codon-optimized S gene of SARS-CoV2 (Wuhan-Hu-1 isolate, accession number MN908947.3) was obtained from GenScript. Site-directed mutagenesis was used to produce the glycan-masking S mutant genes ...
-
bioRxiv - Immunology 2020Quote: ... protein (amino acid residues 1 to 1211) (GenBank: MN908947.3) was gene-synthesized using Cricetulus griseus (Chinese hamster)-preferred codons by GenScript. The cDNA was subcloned into pTRIMER expression vector (GenHunter Corporation ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1 ...
-
bioRxiv - Biophysics 2022Quote: ... Uniprot P13806-1), and rabbit CaVβ3 (477 residues, Uniprot P54286) followed by a Strep-tag II sequence68 were synthesized (GenScript) and each subcloned into a modified pFastBac expression vector having the polyhedrin promoter replaced by a mammalian cell active CMV promoter69 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... 2 × 106 splenocytes from each animal were transferred in a round bottom 96 well plate (200 µl volume) and ex vivo restimulated with 1 µg/ml of the lmon_0149 peptides YSYKFIRV (GenScript) and QVFEGLYTL (made in house by solid phase synthesis ...
-
Allelic diversity uncovers protein domains contributing to the emergence of antimicrobial resistancebioRxiv - Microbiology 2022Quote: ... blocking buffer was removed and replaced with TBST buffer supplemented with 1:30,000 anti-OmpU rabbit primary antibody (GenScript) and incubated for 1h ...