Labshake search
Citations for GenScript :
251 - 300 of 426 citations for 7 Bromo benzooxazole 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... Specific anti-CoV immunoreactivity was detected using SARS-CoV-2 nucleocapsid antibody (GenScript Biotech, Piscataway, NJ, USA) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Microbiology 2023Quote: ... A rabbit anti-SARS-CoV-2 neutralizing antibody (4G6) was purchased from Genscript (Cat. No. A02053-100). Rabbit monoclonal antibodies against 6-His-tags (12698S ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Immunology 2023Quote: ... the standard curve was run using SARS-CoV-2 neutralizing antibodies (GenScript #A02055 and #BS-M0220, respectively). Sample dilution and incubation were identical to the total IgG curve ...
-
bioRxiv - Biophysics 2023Quote: The codon optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... dissolved in sterile H2O at 10mM) and BcNEP2 (Botrytis cinerea Necrosis and Ethylene-inducing protein 2; AIMYSWYMPKDEPSTGIGHRHDWE, Genscript www.genscript.com ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Molecular Biology 2019Quote: ... Readthrough product of rab6 (Figure 1e) was detected using rabbit anti-Rab6 3’UTR antibody (2 μg/ml, GenScript) and revealed with Clean-Blot IP Detection Reagent (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Initial peptide scanning was performed by the binding of a series of SARS-CoV-2 S2 synthetic peptides (GenScript) to immobilized CV3-25 IgG (∼5800 RU ...
-
bioRxiv - Plant Biology 2021Quote: ... The filtered supernatant was mixed with 2 mL slurry of previously washed and equilibrated Glutathione Sepharose 4B beads (GenScript). After incubation ...
-
bioRxiv - Biochemistry 2022Quote: ... Uniprot identifier C3LP26) and Vibrio cholerae serotype O1 (strain M66-2) FeoB (Uniprot identifier C3LP27) were synthesized by GenScript. Materials used for buffer preparation ...
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...
-
bioRxiv - Biochemistry 2022Quote: ... and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.
-
bioRxiv - Microbiology 2022Quote: ... and Omicron (B.1.1.529) Spike genes were based on the codon-optimised spike sequence of SARS-CoV-2 and generated by GenScript Biotech ...
-
bioRxiv - Biochemistry 2020Quote: cDNAs encoding the SARS-CoV and SARS-CoV-2 spike proteins were human codon optimized and synthesized by Genscript. cDNA encoding human ACE2 was obtained from MGC clone 47598 ...