Labshake search
Citations for GenScript :
151 - 200 of 212 citations for 7 BENZYLOXY 3 METHYL 5 NITROINDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... XM_003200755.5), medaka fish (MeMfsd7c, XM_004082328.4), and frog Mfsd7c (XeMfsd7c, NM_001016982.2) coding sequences were synthesized by GenScript and cloned into pcDNA3.1 plasmid for overexpression ...
-
bioRxiv - Cell Biology 2024Quote: ... Drosophila Genetic Research Center) with a synthetic DNA sequence corresponding to the missing 5’ sequence (GenScript). The cDNA corresponding to the mCherry sequence was ligated to the 3’ end of the rdgC cDNA after the removal of the stop codon ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μg protein per sample were separated in 10% SDS gels (SurePAGE Bis-Tris gels, GenScript) for approximately 10 min at 120 V ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were heated to 95°C for 5 min and resolved on 8-16% Bis-Tris gels (Genscript) before being transferred to PVDF membranes using the Iblot2 Dry blotting system (ThermoFishcer) ...
-
bioRxiv - Biophysics 2020Quote: ... Inhibitors included cyclosporin A (CsA, 5 μM), hexacarboxybenzene (HCB, 10 μM) and CPSF6 peptide (100 μM, PVLFPGQPFGQPPLG, Genscript).
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... the PVDF membrane was blocked by 5% skim milk in TBST and incubated with HRP-conjugated streptavidin (GenScript, M00091) for the enhanced chemiluminescence detection ...
-
bioRxiv - Microbiology 2021Quote: ... The resin was washed with 60 mL of buffer A supplemented with 2 mM CaCl2 and the bound protein was eluted from the column with 10 mL of buffer A supplemented with 5 mM EDTA and 0.2 mg/mL FLAG peptide (Genscript).
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Microbiology 2023Quote: ... A full length TgLaforin cDNA containing its endogenous 5’UTR (2000 bp upstream from gDNA) was synthesized by GenScript and inserted into a pHA3x-LIC vector (Table S2 ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Cell Biology 2019Quote: ... DOPE-MPB lipids were then reacted with the terminal cysteine residue of a fluorescent CtermCldn4 peptide (300 nM, 5-FAM-Ahx-CPPRTDKPYSAKYSAARSAAASNYV, GenScript) for 1 hr at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were codon optimized to S. coelicolor A3(2) using Genscript’s OptimumGene™ algorithm (Supplementary Fig. 5) and then synthesized by Genscript. The stop codon removed rAPOBEC1 was fused to the N-terminus of the start and stop codons removed Cas9n (D10A ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Neuroscience 2020Quote: ... The crRNA (0.1nmole) was first annealed with an equimolar amount of transactivating crRNA (tracrRNA) in 5 µl in the annealing buffer (GenScript) by heating at 95°C for 5 min followed by rapid chilling ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Molecular Biology 2022Quote: ... The galanin-GAL1R-Gi complex was formed in membranes by the addition of 5 μM galanin peptide (synthesized by GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Microbiology 2022Quote: ... A sequence in which each CTD serine 5 residue was replaced by an alanine was ordered as synthetic gene (GenScript) and subcloned in place of the wild-type CTD sequence into the G2-CTD construct (G2-CTD-S5A) ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Microbiology 2019Quote: ... 5) was designed using SnapGene software (from GSL Biotech; available at www.snapgene.com) and artificially synthesized by Genscript (Piscataway, NJ, USA). The length of upstream and downstream homology arms were 500 bp long and targeted the chitinase gene from AcMNPV ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...