Labshake search
Citations for GenScript :
1 - 50 of 120 citations for 7 BENZYL 3 7 DIAZABICYCLO 4.2.0 OCTANE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Molecular Biology 2020Quote: ... was directly amplified from a plasmid containing a codon-optimized version of klp-7 (klp-7_co synthetic gene) synthesized from GenScript (Table S5).
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...