Labshake search
Citations for GenScript :
1 - 50 of 223 citations for 6 oxopiperidine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Biochemistry 2023Quote: A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
bioRxiv - Immunology 2021Quote: ... All other peptides were 13 amino acids overlapping by 11 amino acids and were synthesized by GenScript. The peptides covering the envelope (E) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Cell Biology 2019Quote: Fmoc-protected amino-acids were from GenScript USA Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by removal of trifluoroacetic acid (Genscript). When 100 μM of (PR)12 peptide and 0.5 mg/ml of poly-rA RNA were mixed ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Plant Biology 2020Quote: Custom peptide libraries corresponding to NRPD1 amino acids 1-300 or RDR2 amino acids 771-971 were obtained from Genscript and dot-blotted (10 ng ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides (>75% purity by HPLC; 15 amino acids in length overlapping by 11 amino acids) were synthesized by GenScript. To measure T cell responses to the full-length WA-1 S glycoprotein (YP_009724390.1) ...
-
bioRxiv - Developmental Biology 2022Quote: Peptide fragments covering amino acids 55-66 (Genscript) and His-tagged recombinant extracellular domain of Human PTH1R (Cat ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Genetics 2021Quote: ... The consensus amino acid sequence was printed by GenScript and subcloned into the pCI-Rho vector (Promega).
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Immunology 2020Quote: ... The fifteen amino acid CIS43 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NPDPNANPNVDPNANGGGC) ...
-
bioRxiv - Immunology 2021Quote: ... the fifteen amino acid L9 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NANPNVDPNANPNVDGGGC ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Molecular Biology 2023Quote: ... R1R2 peptide66,107 (amino acid sequence: GLNGENQKEPEQGERGEAG-PPLSGLSGNNQGRPSLPGLNGENQKEPEQGERGEAGPP) was manufactured by GenScript ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2020Quote: ... 30-amino acid long peptides (with 15-a.a. overlap) were synthesized (Genscript) covering the conserved C-terminal part of the MERS-S2 ectodomain (residues 869-1,288) ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Biochemistry 2021Quote: Synthetic genes encoding for the selected amino acid sequences were ordered from Genscript and cloned into the pET-28b+ expression vector ...
-
bioRxiv - Biochemistry 2022Quote: The β-barrel (amino acid 21 to 323) subdomain was produced by Genscript Biotech ...
-
bioRxiv - Biochemistry 2022Quote: Synthetic genes encoding for the designed amino acid sequences were obtained from Genscript and cloned into the pET-28a-TEV expression vector ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...