Labshake search
Citations for GenScript :
1 - 50 of 137 citations for 6 chloropyridazine 3 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...