Labshake search
Citations for GenScript :
351 - 400 of 539 citations for 6 Hydroxy 5 2 phenyldiazenyl 2 naphthalenesulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... WT mGluR 2 and mGluR3 peptides encompassing the first 23 residues of each CTD (mGluR2:PQKNVVSHRAPTSRFGSAAPRAS, mGluR3:PQKNVVTHRLHLNRFSVSGTGTT) were purchased from GenScript (Piscataway, NJ) (>= 95% purity) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Molecular Biology 2023Quote: ... R1R2 peptide66,107 (amino acid sequence: GLNGENQKEPEQGERGEAG-PPLSGLSGNNQGRPSLPGLNGENQKEPEQGERGEAGPP) was manufactured by GenScript ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Microbiology 2022Quote: ... Mice from WT and CST-KO groups were injected intraperitoneally once daily with CST (2 μg/g body weight; Genscript Biotech Corporation, Piscataway, NJ) for 15 days based on previous experimentation 15 ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA for SARS-CoV-2 Spike protein ectodomain residues 1 to 1220 (S-Ectodomain-GFP) was chemically synthesized with optimal insect cell codons (Genscript USA Inc, NJ, USA) and cloned into pVL1393 (Expression Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Microbiology 2020Quote: ... 30-amino acid long peptides (with 15-a.a. overlap) were synthesized (Genscript) covering the conserved C-terminal part of the MERS-S2 ectodomain (residues 869-1,288) ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Microbiology 2022Quote: ... The pcDNA3-SARS-CoV-2-Spike plasmid contains a codon- optimized ORF for Spike from GenBank NC_045512 that was synthesized by GenScript (a kind gift from David Kelvin) then cloned between the KpnI and BamHI sites of pcDNA3.1(+) ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2021Quote: Synthetic genes encoding for the selected amino acid sequences were ordered from Genscript and cloned into the pET-28b+ expression vector ...
-
bioRxiv - Biochemistry 2022Quote: The β-barrel (amino acid 21 to 323) subdomain was produced by Genscript Biotech ...
-
bioRxiv - Biochemistry 2022Quote: Synthetic genes encoding for the designed amino acid sequences were obtained from Genscript and cloned into the pET-28a-TEV expression vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were purchased from Santa Cruz Biotechnology (item sc-222407, sodium ursodeoxycholic acid, ≥98% purity) or synthesized by Genscript ((pyroE)WLGGRFamide ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Bioengineering 2020Quote: ... in the presence of varying amounts of argininylglycylaspartic acid (RGD, CGRGDS, 2.0 mM, Genscript, George Town, KY), heparin-binding peptide (HBP ...
-
bioRxiv - Biochemistry 2022Quote: ... A peptide corresponding to the human CRX homeodomain (amino acids 39 to 98) was synthesized by Genscript.
-
bioRxiv - Immunology 2022Quote: RBD-CompA gene based on previously described amino acid sequence [24] was synthesized and cloned by Genscript in the pcDNA3.4+ vector.
-
bioRxiv - Biophysics 2023Quote: ... Some single amino acid mutants were generated by site-directed mutagenesis and others were purchased synthesized (GenScript).
-
bioRxiv - Cell Biology 2024Quote: A E.coli codon optimized DNA fragment corresponding to amino acids 32-442 of RON11 was synthesized (Genscript) and cloned into pMAL vector (NEB ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...