Labshake search
Citations for GenScript :
201 - 250 of 295 citations for 6 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: The HTP-3 antibody used in this study was generated from an identical C-terminal segment of the HTP-3 protein (synthesized by GenScript) as was used by (MacQueen et al ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Microbiology 2022Quote: ... plasmid pUC57-KRV-9000-11375 containing part of NS5 gene and the 3’ UTR of KRV (nt 9000-11375) was synthesized by GenScript.
-
bioRxiv - Immunology 2020Quote: ... zooepidemicus lacking the N-terminal signal seqence was synthesized and cloned into pGEX-6P-3 expression vector using BamHI and SalI restriction sites (Genscript). E ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Genomics 2022Quote: ... a 9 base pair(bp)’Spatial barcode A’,(3) a 12bp anchor sequence(/AmC6/CTACACGACGCTCTTCCGA-Spatial barcode A-ACTGGCCTGCGA) (Genscript). To enlarge the barcode pool ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Neuroscience 2022Quote: ... A matching clone in which all TAG triplets in the 3’-UTR were mutated to TGA to disrupt the Musashi binding sites was created using gene synthesis (Genscript). Gibson assembly was used to reclone the cDNAs into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: Pre-validated gRNA sequences targeting the exon 3 of BMP4 or BMP7 gene were obtained from genome-wide databases provided by GenScript (https://www.genscript.com/gRNA-database.html ...
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein samples were separated by SDS-PAGE on 4-12% gradient gels (ExpressPlus, Genscript, New Jersey, NJ, USA). Each gel lane was cut into 6 equal slices ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were separated by SDS-PAGE on 4–20% Tris-Glycine or SDS-MOPS gradient gels (GenScript, USA) and transferred onto PVDF membranes (Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Cell Biology 2022Quote: 15 to 30 µg of total protein samples were resolved on ExpressPlus™ PAGE 4–20% gels (GenScript), in MOPS running buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... following the manufacturer’s instructions and protein samples were loaded on gradient 4-20% Tris-MOPS-SDS gels (GenScript). The resolved proteins were then transferred to PVDF membranes (BioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... equal amounts of lysates were loaded and separated by SDS-PAGE using 4-12% SurePAGE Bis- Tris (GenScript) or 3-8% NuPAGE Tris-Acetate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and PdCoV0081-4 ( Accession # MW685622.1, aa1-1092 with E854P and V855P mutations) were synthesized and cloned into pCDNA3.1- vectors (Genscript) with the following C-terminal modifications ...
-
bioRxiv - Microbiology 2019Quote: ... Lysate supernatants were incubated overnight at 4°C with anti-flag monoclonal antibody coated on agarose beads (Genscript). The beads were then washed five times in wash buffer (50mM Tris-HCl pH 7.5 ...
-
Chemical Stabilization of the HIV-1 Capsid Results in Efficient HIV-1 Reverse Transcription in vitrobioRxiv - Microbiology 2020Quote: ... 15 μl volumes of the gradient fractions were separated by electrophoresis on precast 4-20% polyacrylamide gels (Genscript). The proteins were transferred to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: Proteins in the digesta were separated and quantified by SDS-PAGE with 4-20% precast gel (Genscript, USA). Each sample was diluted and mixed with 5× loading buffer to reach the concentration of 4 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral vector encoding CD19 specific CAR (CD19-CD8-4-1BB-CD3z) was designed and synthesized by GenScript. The envelope pCMV-VSV-G plasmid (from Bob Weinberg (Addgene #8454 ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Microbiology 2021Quote: ... a synthetic 999 bp fragment of the recodonized version of the CpMetRS (starting from amino acid number 247) along with the 3’UTR sequence of the enolase gene (cgd5_1960) was purchased (GenScript, NJ, USA). The synthetic construct was PCR amplified to introduce desired mutations and the 5’ homology region was introduced as an overhang in the forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with an empty vector (PC) or a vector against Bach1 with the following gRNA 5’ GCGGTTCCGAGCCCACCGCT 3’ (GenScript Biotech Corporation, USA) (BACH1 KO ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was quenched by SDS sample buffer and analyzed by 4-20% SDS-gel (GenScript, Piscataway, NJ, US). Fluorescent ubiquitin signals were imaged using Thermo iBright exposed for 750 ms.
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were recovered and 20 μg protein were separated on SurePAGE Bis-Tris 4-12% gradient gel following the manufacturer’s instructions (Genscript). A protein standards ladder (BioRad #1610374 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: Codon optimized RdRp and VPg genes of HuNoV GII.4 Sydney strain (GenBank: AFV08794.1) were synthesized and cloned in the pET28a vector for bacterial expression by Genscript U.S.A ...
-
bioRxiv - Biochemistry 2023Quote: ... Then the samples were boiled at 95°C for 15 min and run on 4-20% polyacrylamide gels (GenScript).
-
bioRxiv - Biochemistry 2023Quote: ... vector with eGFP on C-terminal and GII.4 VPg was cloned in pcDNA3.1(+) vector with mCherry on N-terminal by Genscript U.S.A ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysate from equal number of DRGs was loaded and separated by electrophoresis on 4-12% ExpressPlus gels (Genscript M41210), followed by transfer to a PVDF membrane ...
-
bioRxiv - Biochemistry 2023Quote: The genes encoding full-length TcdB toxin variants (TcdB1,3 and 4) were synthesized with a C-terminal His-tag and cloned into pC-His 1622 by Genscript. The pC-His1622 vector was purchased from MoBiTec ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was separated from the insoluble material by ultracentrifugation at 180,000g for 30 min and incubated with 4 mL of Anti-DYKDDDDK G1 resin (Genscript) for 1 hour at 4℃ ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2021Quote: ... and JPS-G3 VHHs [20] separated by 15-amino acid flexible glycine-serine linkers ((GGGGS)3) was synthesized (GenScript Biotech, Piscataway, NJ) and ligated into pET32b(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with a unique 5′fluorescent reporter dye (FAM) and 3 fluorescent quencher dye (TAMRA) were designed using mouse mitochondrial genome sequences and synthesized by Genscript (Piscataway, NJ). For absolute quantification using qPCR ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 UTR that was amplified with primers 1045.C13 and 1045.C14 from a gene synthesized vector (GenScript, Piscataway, NJ) was cloned using EA cloning ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Cell Biology 2023Quote: ... Additional 5’ (GCTAGCA) and ‘3 sequences (CTTAAG) were added to the cDNA to carry out the cloning procedure (GenScript, Piscataway, NJ, USA). The inactive UGGT1 D1454A variant was generated with direct mutagenesis by GenScript ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... A DNA fragment for a floxed transcription stop transcription site (3 copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ) and inserted into pUC57-Kanamycin plasmid ...
-
bioRxiv - Immunology 2024Quote: ... M2 ORF of Ca/04 and 83 nucleotides of the 3’ end of the PB1 gene (40 nucleotides encoding the C-terminus of PB1 ORF and 43 from the 3’UTR region) was synthesized by Genscript (Piscataway, NJ). The fragments were digested with BsmBI ...