Labshake search
Citations for GenScript :
1 - 50 of 763 citations for 6 Fluoro 4 hydroxy 1 7 naphthyridine 3 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Microbiology 2023Quote: ... phage 1/4 Gad1 was used and synthesized by Genscript. Gad1 and related homologs were cloned into the pSG-thrC-Phspank vector40 and transformed to DH5α competent cells ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: ... let-7 and miR-17-92 and ordered from GenScript Biotech ...
-
bioRxiv - Biochemistry 2023Quote: Five constructs (P2-6, Figure 1) were synthesised and cloned in to the pFastBAC1 vector by Genscript. The Mellitin signal sequence to direct secretion of the expressed protein (26 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... The following antibodies were used: anti-GluA2/3 (1:2000; CQNFATYKEGYNVYGIESVKI, custom made at Genscript) (Chen et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Microbiology 2021Quote: ... The “i6×7” intron (GenBank: AF179904.1 nucleotide 2988 to 3740) was synthesized by Genscript. The K18JAX (originally named K18i6×7PA ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Cell Biology 2024Quote: MeHA hydrogels were formed from a 3% w/v MeHA macromer solution functionalized with 1 mM RGD peptide (GenScript) in 0.2 M Triethanolamine (TEOA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...