Labshake search
Citations for GenScript :
51 - 100 of 532 citations for 6 Fluoro 2 methylindole 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The consensus amino acid sequence was printed by GenScript and subcloned into the pCI-Rho vector (Promega).
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Immunology 2020Quote: ... The fifteen amino acid CIS43 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NPDPNANPNVDPNANGGGC) ...
-
bioRxiv - Immunology 2021Quote: ... the fifteen amino acid L9 epitope peptide was synthesized (GenScript) and modified to contain a C-terminal gly-gly-gly-cys linker sequence (NANPNVDPNANPNVDGGGC ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Larger mutations (Indels >1 amino acid) were performed by GenScript directly using the previously synthesized construct as a template ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Molecular Biology 2023Quote: ... R1R2 peptide66,107 (amino acid sequence: GLNGENQKEPEQGERGEAG-PPLSGLSGNNQGRPSLPGLNGENQKEPEQGERGEAGPP) was manufactured by GenScript ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Δ401-605 amino acids (#U617HEL120-7) were purchased from GenScript. For the knockdown (KD ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2020Quote: ... 30-amino acid long peptides (with 15-a.a. overlap) were synthesized (Genscript) covering the conserved C-terminal part of the MERS-S2 ectodomain (residues 869-1,288) ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Microbiology 2024Quote: A 17 amino acid mature SilCR peptide (DIFKLVIDHISMKARKK) was synthesized by Genscript. After reconstitution ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Biochemistry 2021Quote: Synthetic genes encoding for the selected amino acid sequences were ordered from Genscript and cloned into the pET-28b+ expression vector ...
-
bioRxiv - Biochemistry 2022Quote: The β-barrel (amino acid 21 to 323) subdomain was produced by Genscript Biotech ...
-
bioRxiv - Biochemistry 2022Quote: Synthetic genes encoding for the designed amino acid sequences were obtained from Genscript and cloned into the pET-28a-TEV expression vector ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’-AATTCGGTCATGCCAGCGTA-3’) to target the mFoxO1gene and scrambled sgRNA (Sc-sgRNA) (5’-GCGAGGTATTCGGCTCCGCG-3’) were custom made by Genscript (Piscataway, NJ).
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were purchased from Santa Cruz Biotechnology (item sc-222407, sodium ursodeoxycholic acid, ≥98% purity) or synthesized by Genscript ((pyroE)WLGGRFamide ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... and 2 were synthesized by Genscript. RTKs were cloned into MAC-TAG-C expression vector (Liu et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Angiopep-2 was obtained from GenScript. Puromycin dihydrochloride ...
-
bioRxiv - Immunology 2020Quote: ... Pseudotyped SARS-CoV-2-S (Genscript), full-length recombinant S protein (Acrobio systems) ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...