Labshake search
Citations for GenScript :
201 - 250 of 689 citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Synthetic peptides of P covering the sequence N-EDDIYQLIM-C were obtained from GenScript. The peptide was dissolved in deionised water dosed with a drop of 5 M NH4OH to improve solubility ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biophysics 2022Quote: ... All constructs were designed with GFPmut1 fused to the N-terminus and synthesized by GenScript. The plasmids were electroporated into P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pcDNA3.1-FLAG-FNIP1 and the pcDNA3.1+N-eGFP-FLCNΔE510 vectors were generated by Genscript. The pIRES2-FLCN plasmids were kindly provided by Dr ...
-
bioRxiv - Biophysics 2020Quote: ... and FEZ1 peptide (M174-L188, with N-terminal extension containing a cysteine residue (KCGGSGGMMQNSPDPEEEEEVL, Genscript) were labelled with Alexa Fluor 488-C5-maleimide at 1:1 molar ratio in 50 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... N-terminal biotinylated peptides of PyCSP[NXA] listed in Table 1 were obtained from GenScript and used in epitope mapping ELISAs.
-
bioRxiv - Physiology 2023Quote: ... Tyrosine-substituted (Y134A) and N-terminal (1-96 aa) truncated mutants were purchased from GenScript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Cell Biology 2020Quote: Sequences of full length hsRIPK2 with an N-terminal 3x-Flag tag were synthesized by Genscript and cloned into doxycycline-inducible lentiviral expression vectors (pF_TRE3G_rtTAAd_puro (Takara Bio)) ...
-
bioRxiv - Biochemistry 2020Quote: ... archaeon HeR gene (GenBank ID: KYK26602.1) containing an N-terminal histidine-tag was chemically synthesized (GenScript) and subcloned into the pET21a (+)-vector ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse α-DG lacking the N-terminal domain (H30 – A316) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the muscle-specific MCK promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The N-terminal 3xFlag tag was removed by incubation with the GST tagged Prescission Protease (GenScript) (final 0.01U/ul ...
-
bioRxiv - Biochemistry 2023Quote: N-terminally biotinylated synthetic MUC1 peptide with the sequence biotin-GGS-APDTRPAPG was ordered from Genscript. This was dissolved in PBS and printed on a planar streptavidin-coated SPR chip (P-Strep ...
-
bioRxiv - Microbiology 2023Quote: ... a custom-synthetized N-terminally biotinylated peptide comprising residues Met1 to Gln38 of LmdC (GenScript, USA) was immobilized on the biosensors ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The DNA fragments corresponding to the N-termini of archaeal uS12 were purchased from GenScript (https://www.genscript.com) and cloned into the H ...
-
bioRxiv - Biochemistry 2021Quote: Purified PX domain was specifically labeled on its N-terminal glycine with a FITC-LPETGG peptide (Genscript) in a Sortase-mediated reaction according to the protocol described in (Theile et al ...
-
bioRxiv - Plant Biology 2019Quote: ... The N-terminal part of the PKL protein (aa 1-586) was synthetized by GenScript (http://www.genscript.com). Details of the molecular cloning work are provided in the Supplementary Experimental Procedures.
-
bioRxiv - Biochemistry 2022Quote: ... and human CDC73 sequences with an N-terminal Flag tag were synthesized and sequences confirmed by GenScript. The human ubiquitin sequence with an inserted N-terminal cysteine residue was synthesized by Eurofins ...
-
bioRxiv - Neuroscience 2022Quote: ... codon optimized mouse Pcbp2 clone with N-terminal Flag epitope tag was produced by gene synthesis (Genscript) and cloned in pcDNA3.1 (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: The codon-optimized sequence coding for the wild type (WT) N (stain Long) was syn-thetised (GenScript) and cloned in the pFastBac Dual vector under the control of the polyhedrin promoter at BamHI and SalI sites ...
-
bioRxiv - Biochemistry 2023Quote: ... and H2A.Z N-terminal tail peptides with and without modifications were purchased from GenScript (Piscataway, NJ, USA). Amino-acid sequence information of each peptide is available in Table 1 ...
-
bioRxiv - Biophysics 2023Quote: All HP1α tagged constructs with a 6x-His tag on the N-terminus were ordered from Genscript. Rosetta competent cells (Millipore Sigma 70954 ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2021Quote: ... BIOD2-nlsKO-ARS2n mutant was generated by mutagenesis of BIOD2-ARS2n and subcloned in pcDNA3.1(+)-N-eGFP (GenScript). All constructs were validated by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... 2.5×106 splenocytes were stimulated with S or N peptide libraries (GenScript, 15mers with 11aa overlap, 1μg/ml), 0.1% DMSO ...
-
bioRxiv - Cell Biology 2021Quote: N-terminally Histidine (His)-tagged Bin1b SH3 from zebrafish was cloned into pET-28a (+) expression vector (GenScript®). Full length zebrafish Cavin4a (Cavin4a-FL ...
-
bioRxiv - Biochemistry 2020Quote: Full-length wild-type human ASPA cDNA with an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). The C152W variant was generated by Genscript ...
-
bioRxiv - Immunology 2021Quote: ... All neutralization assays performed with the surrogate Virus Neutralization Test (sVNT) (cat. n° L00847, GenScript, Piscataway, NJ, USA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... as the primary antibody and anti-Rabbit IgG conjugated to HRP (cat. n° A01827, GenScript, Piscataway, NJ, USA) (2/5000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The plasmid encoding human FPR2 with an N-terminal SNAP-tag was obtained from Genscript (Piscataway, NJ, USA); it was constructed by replacing GLP1R in the previously described pcDNA3.1(+)-Flag-SNAP-GLP1R plasmid [26] with human FPR2 ...
-
bioRxiv - Microbiology 2022Quote: ... Peptides were commercially synthesized and biotin-labeled on the N-terminus using Fmoc chemistry (GenScript, Piscataway, NJ, USA). Sequences of these peptides are shown in Table 1.
-
bioRxiv - Molecular Biology 2020Quote: Full-length wild-type human FLCN cDNA carrying an N-terminal RGS6xHis-tag was expressed from pcDNA3.1 (Genscript). USP7 was expressed with an N-terminal myc-tag from pcDNA3.1 (Genscript) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-Fyve is generated by insertion of synthesized SARA1 Fyve domain into pCDNA3.1+N-EGFP plasmid from Genscript as described 40 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...
-
bioRxiv - Microbiology 2021Quote: ... ACE-2 –Fc (GenScript Z033484) was diluted at 1.2µg/ml in HBS P+ (Cytiva ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... two polypeptides with the sequence MQDDLLMDKSKTGGGGASSSWNTHQ (with and without an N-terminal Dansyl group) were also obtained from Genscript. All the peptides were over 95% pure ...
-
bioRxiv - Cell Biology 2019Quote: Chemically synthesized peptides bearing an N-terminal FITC-Ahx modification (Figure S2C) were purchased from from GenScript (Piscataway, NJ), Peptide stock solutions were prepared in milli-Q H2O except LEM275-122 stocks ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 variant spike constructs with N- and C-terminal flag tags were produced and cloned into a pcDNA3.1 vector by GenScript Biotech (Piscataway ...
-
bioRxiv - Microbiology 2020Quote: ... was synthesized with a modified tPA signal peptide (57) at the N-terminus and cloned into the vector pcDNA3.1+ at the cloning sites of KpnI/NotI (GenScript). Expi293 cells (Thermo Fisher ...
-
bioRxiv - Genetics 2022Quote: ... Human GKRP (Ensembl ENST00000264717.7) was codon optimized for yeast expression and cloned into pDONR221 with an N-terminal HA-tag (Genscript). For yeast expression ...