Labshake search
Citations for GenScript :
151 - 200 of 546 citations for 6 Bromo 4 trifluoromethyl benzo d thiazole 2 thiol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Cell Biology 2020Quote: ... AAV production protocols were modified to include polyethylenimine co-transfection of an AAP-6 expression plasmid (ORF under the control of the CMV promoter, synthesized by GenScript Biotech), the variant 5 AAV cap plasmid ...
-
bioRxiv - Immunology 2020Quote: ... and cultured in the presence of Phl p 6 or the mutants (20µg/mL) or individual peptides of a 15mer library (GenScript, NJ, USA) with an offset of 3 amino acids (10µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Biochemistry 2020Quote: ... The reaction mixture was directly loaded on the 4-20% SDS-PAGE gel (GenScript) following addition of 4× laemmli loading buffer ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...
-
bioRxiv - Cell Biology 2022Quote: ... Whole worm lysates were then separated on 4-12% polyacrylamide gradient gels (GenScript, #M00654), transferred to membranes ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were visualized by SDS-PAGE (4-20% gradient gel, Sure Page Gels, GenScript), and band intensity was determined using Image Lab (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... the reaction products were loaded onto 4∼20% SDS-PAGE gels (GenScript Biotech, China), and then the signals were obtained by western blotting.
-
bioRxiv - Cell Biology 2024Quote: pcDNA3.1 vectors expressing human caspase-4 and human IL-18 were purchased from Genscript. Mutagenesis primers were designed using Aligent Quik change primer design ...
-
bioRxiv - Cell Biology 2020Quote: ... Sec16A fragment with eight serines in the ELD mutated to alanines (S/A) or aspartates (S/D) was synthesized by Genscript (USA) and inserted into mCherry-Sec16A (IDR ...
-
bioRxiv - Immunology 2019Quote: ... B10.RIII mice (female, 6 to 8 weeks old, n = 8) were immunized with 100 μg IRBP160-181 peptide (GenScript, Piscataway, N.J.) dissolved 100 μl PBS emulsified in 100 μl of complete Freund’s adjuvant ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Microbiology 2022Quote: ... codon optimized genes encoding each PcaLOOL were obtained as subcloned in pPICZαA plasmids with a C-terminal 6 x His tag (GenScript, Piscataway, NJ, USA). P ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 12 μl were resolved on precast ExpressPlus 4-12% gradient gel (GenScript #M41212). Proteins were electroblotted to nitrocellulose membrane ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Neuroscience 2023Quote: ... 10Lμg of tissue lysates were resolved on a 4–12% Bris-Tris gel (M00668, GenScript) and transferred onto a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Plant Biology 2023Quote: Protein samples were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) or 10% SDS-PAGE gels and electrophoresed at 150 V for 2 h ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli codon-optimized 10xHis- PPEP-4 (lacking the signal peptide) construct was ordered from GenScript. The pET-16b 10xHis-PPEP-4 plasmid was transformed to E ...
-
bioRxiv - Microbiology 2020Quote: ... and a custom-made rabbit polyclonal antibody against the NP of influenza D/bovine/Oklahoma/660/2013 strain (Genscript, Piscataway, NJ, USA) were used ...
-
bioRxiv - Immunology 2022Quote: Chronic progressive EAE was induced by subcutaneous immunization of female 6- to 8-week-old C57BL/6 mice (Janvier Labs, France) with 200 µL of a Myelin Oligodendrocyte Glycoprotein solution (200 µg,MOG35-55 peptide: Genscript, New Jersey, USA) emulsified in complete Freund’s Adjuvant (CFA ...