Labshake search
Citations for GenScript :
101 - 150 of 1103 citations for 6 4 METHOXY PHENYL 3 METHYL IMIDAZO 2 1 B THIAZOLE 5 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Developmental Biology 2019Quote: Variant #1: a FseI-HH-gRN(#2)NA#1-HDV-HindIII fragment was de novo synthetized (Genscript). This contains a conditional gRNA#1 activatable by the gRNA#2 and flanked by the Hammerhead and HDV ribozymes (29) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Cell Biology 2023Quote: ... accession number XM_006514830.3) and type 3 (transcript variant 1, accession number NM_001363282.1) was purchased from GenScript (Clone IDs OMu45282 and OMu45285 ...
-
bioRxiv - Microbiology 2022Quote: ... mutant A and mutant B without signal peptides were synthesized by GenScript USA ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Biochemistry 2021Quote: ... Cells were plated in a 6 well plate and co-transfected with 1 μg of pUC57-NASP-FKBP12F36V (by Genscript) and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988 ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Physiology 2021Quote: ... PC-1 and PC-2 coiled-coil domain peptides were custom-made (Genscript). PC-1 or PC-2 peptides were added to pipette solution immediately before use at a final concentration of 1 μM ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 Wuhan-Hu-1 RBD construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of clade B HIV-1JR-FL Env53 was codon optimized (GenScript) and cloned into expression plasmid pcDNA3.1(- ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Molecular Biology 2024Quote: ... mouse anti-Strep-tag (IBA, 2-1507-001, 1:1,000) rabbit anti-CBP-tag (GenScript, A00635-40, 1:1,000), mouse anti-V5-tag (Proteintech Group ...
-
bioRxiv - Biophysics 2020Quote: The gene corresponding to residues 1-201 of colicin 5 (colE5-T) was synthesized (GenScript) and cloned into pET21(+ ...
-
bioRxiv - Bioengineering 2019Quote: ... (3) the 3’UTR region of the corresponding U6 snRNA was gene synthesized by GenScript; (4 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Immunology 2020Quote: The SARS-CoV-2 pseudovirus was produced by co-transfection of HEK293T cells with 1:1 ratio of DNA plasmid encoding SARS-CoV-2 S protein (GenScript) and backbone plasmid pNL4-3.Luc.R-E-(NIH AIDS Reagent ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2020Quote: A human Kif15 motor domain and neck linker construct (Kif15_MD residues 1-375) in a pET21a vector with a C-terminal 6 x His-tag was generated by chemical synthesis (GenScript, Piscataway, NJ). Six of the eight cysteine residues (C5S ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... 220 kDa ankyrin-B F131Q/F164Q (Wang et al., 2014) was created by Genscript by site-directed mutagenesis ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV2 RBD-L452R construct California-B.1.429 (L452R) was synthesized by GenScript into CMVR with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag (GHHHHHHHH ...
-
bioRxiv - Microbiology 2024Quote: ... followed by primary staining of cells with rabbit anti-N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Cell Biology 2024Quote: MeHA hydrogels were formed from a 3% w/v MeHA macromer solution functionalized with 1 mM RGD peptide (GenScript) in 0.2 M Triethanolamine (TEOA ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Bioengineering 2021Quote: Purified RfxCas13d proteins and synthetic crRNAs were mixed (unless otherwise indicated) at 2:1 molar ratio in Buffer 1 (GenScript SC1841) or Buffer 22 (25mM Tris pH 7.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated with 1:7000 polyclonal anti-Bma-LAD-2 peptide antibodies (Genscript) and 1:1000 rabbit anti-β actin antibodies (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (GenScript, USA) in carbonate bicarbonate buffer (pH 9.6 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...