Labshake search
Citations for GenScript :
51 - 100 of 599 citations for 6 1 Azepanyl 3 pyridinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) using polyethylenimine (PEI ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: The previously designed 3 gRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Immunology 2022Quote: The coding sequences for the extraviral domain of VARV A33 with N terminus 6×His tag and C-terminus Avi-tag were synthesized by GenScript and directly cloned into the PET-28a(+) ...
-
bioRxiv - Plant Biology 2020Quote: ... coli codon-optimized gene for Arabidopsis UVR8 was introduced into the pET11a expression vector generating a construct carrying an N-terminal 6×His-tag (Genscript). The construct was verified by DNA-sequencing and transformed into the E ...
-
bioRxiv - Biophysics 2021Quote: ... Both ghrelin receptor–Gq complexes were formed on the membrane in the presence of 10 μM ligands (ghrelin or GHRP-6, synthesized by GenScript) and treated with apyrase (25 mU/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... T4-foldon trimerisation domain and ADAH11 spaced by glycine-serine linker sequences (Supplementary Table 6) was inserted into the pHEN6 plasmid (Genscript), expressed in T7 Express E ...
-
bioRxiv - Molecular Biology 2023Quote: A DNA library (Supplementary Table 6, 7) comprising seven random nucleotides was created and subsequently cloned into the plasmid pUC18 by GenScript. This random library was transformed in XL1blue E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and Solanum lycopersicum flavanone 3-hydroxylase (SlF3H) were optimized and synthesized by GenScript (Nanjing, China). Genes encoding Yarrowia lipolytica pentafunctional arom protein (YlARO1) ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The following gRNA sequence targeting ATF3 was cloned into plentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript). HEK293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... AAV production protocols were modified to include polyethylenimine co-transfection of an AAP-6 expression plasmid (ORF under the control of the CMV promoter, synthesized by GenScript Biotech), the variant 5 AAV cap plasmid ...
-
bioRxiv - Immunology 2020Quote: ... and cultured in the presence of Phl p 6 or the mutants (20µg/mL) or individual peptides of a 15mer library (GenScript, NJ, USA) with an offset of 3 amino acids (10µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Biochemistry 2024Quote: ... After electrophoresis (80 V for 3 h) using Tris-MOPS-SDS buffer (GenScript; Piscataway, NJ, USA), proteins were transferred onto a 0.2 µm pore size nitrocellulose membrane (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2024Quote: ... GO grids were first incubated with 3 µL of 250 nM recombinant protein G (Genscript Z02007) in resuspension buffer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LNP #3 (ALC0315) and LNP #4 (LP01) encapsulating f-luciferase mRNA also were provided by Genscript.
-
bioRxiv - Immunology 2019Quote: ... B10.RIII mice (female, 6 to 8 weeks old, n = 8) were immunized with 100 μg IRBP160-181 peptide (GenScript, Piscataway, N.J.) dissolved 100 μl PBS emulsified in 100 μl of complete Freund’s adjuvant ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-PFOR over-expression in the 6-L cultures was assessed by SDS PAGE analysis followed by immunoblotting with a His-tag specific antibody (GenScript; Fig S7). A specific band could be detected in the over-expression mutant ...
-
bioRxiv - Microbiology 2022Quote: ... codon optimized genes encoding each PcaLOOL were obtained as subcloned in pPICZαA plasmids with a C-terminal 6 x His tag (GenScript, Piscataway, NJ, USA). P ...
-
bioRxiv - Biophysics 2019Quote: ... TRPV2 was eluted with Wash Buffer containing 0.006% DMNG and 3 mg/ml 1D4 peptide (GenScript USA) and subjected to size-exclusion chromatography using a Superose 6 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2019Quote: RP3: ({RRASL}3) and RP3C: ({RRASL}3C) were ordered and custom synthesized from GenScript (New Jersey, USA) at ≥95% purity ...
-
bioRxiv - Microbiology 2021Quote: Both wild type and edited MARV NP 3’UTR coding sequences were synthesized by Genscript (Piscataway, NJ). For amplifying the remaining MARV UTRs purified total RNA from MARV infected THP1 cells at 24 hours post infection was used for cDNA synthesis ...
-
bioRxiv - Biophysics 2024Quote: Macroscopic potassium currents (whole-cell currents) were recorded 2-3 days after injection of hKir2.1 cDNA (Genscript) using a two-electrode voltage-clamp amplifier (OC-725C ...
-
bioRxiv - Immunology 2022Quote: Chronic progressive EAE was induced by subcutaneous immunization of female 6- to 8-week-old C57BL/6 mice (Janvier Labs, France) with 200 µL of a Myelin Oligodendrocyte Glycoprotein solution (200 µg,MOG35-55 peptide: Genscript, New Jersey, USA) emulsified in complete Freund’s Adjuvant (CFA ...
-
bioRxiv - Developmental Biology 2020Quote: The fraction of mouse Tbx4-lung mesenchyme specific enhancer (LME) (mm10, chr11:85,893,703-85,894,206, GenScript, ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... A synthetic gene coding for the Bacillus subtilis glmS ribozyme and PvAc-3’U was obtained from (GenScript), and cloned into the HB-PfCul2/cDDHA plasmid at XhoI/AgeI site ...
-
bioRxiv - Developmental Biology 2023Quote: ... Wild type or a mutant version of the human PDX1 enhancer with 6 CisBP predicted RFX binding motifs mutated (Weirach et al 2014) were commercially synthesized by Genscript (Genscript USA, Piscataway, NJ) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...