Labshake search
Citations for GenScript :
1 - 50 of 622 citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... basic and Methyl-mimic mutants were synthesized by Genscript with N-terminal NheI and C-terminal Acc65I restriction enzyme site s flanking the DUX4 ORF ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 and 6 wt% NorHA hydrogel precursor solutions containing 1 mM thiolated RGD (GCGYGRGDSPG, Genscript) and dithiothreitol (DTT ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Molecular Biology 2024Quote: 5 µM STAT3136–705 (purified as described in 6) was incubated with 25µM phosphopeptides (Genscript, Piscataway, New Jersey) from the binding sites of gp130 (SGpYRHQVPSV) ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Immunology 2022Quote: ... 6 and 8 were analyzed with the cPass™ SARS-CoV- 2 neutralization antibody detection kit (GenScript, Cat #L00847) to detect any antibodies that neutralize the interaction between the RBDdelta and the ACE2 receptor ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Evolutionary Biology 2020Quote: ... We ordered 6 libraries from GenScript® ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant mouse interleukin-6 (Z02767, Genscript) was dissolved in PBS and injected IP at a dose of 200 mcg/kg ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Microbiology 2021Quote: ... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2024Quote: ... N112C-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-6/PD43863) plasmids used for mammalian cell over-expression were purchased from GenScript ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Synthetic Biology 2019Quote: ... were codon optimized to S. coelicolor A3(2) using Genscript’s OptimumGene™ algorithm (Supplementary Fig. 5) and then synthesized by Genscript. The stop codon removed rAPOBEC1 was fused to the N-terminus of the start and stop codons removed Cas9n (D10A ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptide-pulsing of target cells was performed by incubating EBV-LCLs in FBS-free medium at a density of 5×106 cells/ml for 2 hours in the presence of individual peptides (107 pg/ml, Genscript). After an overnight incubation ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Bioengineering 2021Quote: ... Peptides (chemically synthesized by Genscript, Supplementary Table 6) were suspended in DI H2O ...
-
bioRxiv - Immunology 2022Quote: ... 6) TCRβ-CD3γ crosslinking: rabbit anti-V5 (Genscript) and mouse anti-VSV-G (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were pretreated with interleukin 4 (IL-4) (Cat. # Z02925-10, GenScript) at a concentration of 5 ng/ml for 24h ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Biochemistry 2023Quote: ... GII.4 RdRp-NΔ13 and GII.4 RdRp-NΔ51 were also generated by Genscript U.S.A ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...