Labshake search
Citations for GenScript :
1 - 50 of 744 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Immunology 2020Quote: ... synthesized de novo (Genscript), then cloned into pcDNA3.1(+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized de novo by GenScript. The zebrafish codon optimized emiRFP2 gene was cloned by substituting the nucleotides encoding RpBphP1-based N-terminus of zebrafish codon optimized miRFP2 (aa 2-19 ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized de novo by GenScript and cloned into an expression vector under the tag-168 promoter the drives pan-neuronal expression.
-
bioRxiv - Plant Biology 2022Quote: ... synthesized de novo by GenScript Corporation ...
-
bioRxiv - Plant Biology 2020Quote: ... coli and de novo synthesized (Genscript) including a five amino acid long C-terminal linker sequence and an eight amino acid long His-tag ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which was synthesized de novo (GenScript) and ABCH2 ORF was subcloned in between BamHI and EcoRI restriction enzyme sites ...
-
bioRxiv - Biophysics 2024Quote: ... coli and cloned into the 5’BamHI and 3’XhoI sites of pGEX6P-1 (GenScript).
-
bioRxiv - Molecular Biology 2023Quote: ... and either amplified from a clinical isolate (FR-3 and Muc) and cloned into a modified pUC19 backbone (fragments A-D) or de novo synthesized (GenScript) and cloned into a pUC57 backbone (fragments A-C).
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Microbiology 2024Quote: ... DNA fragments were synthesized de novo (Genscript) and amplified by PCR ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in Table S6) ...
-
bioRxiv - Bioengineering 2024Quote: ... The SLK peptide was synthesized de novo (GenScript) and modified to contain a C-terminal linker sequence gly-gly-gly-cys (NTGDKFYGLM-GGGC) ...
-
bioRxiv - Genomics 2024Quote: ... De novo gene synthesis from GenScript (Piscataway, NJ) was used for the synthesis of the two constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... The FAM-labeled fluorescent FTH-1 IRE probe with the sequence 5’- UCCUGCUUCAACAGUGCUUGGACGGAAC-3’ was prepared by GenScript Biotech (Netherlands) ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2024Quote: ... Tween20) for 1h and probed with the following primary antibodies: rabbit anti-DYKDDDDK-tag (1:2000, GenScript, #A00170) and mouse anti-actin (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The novel oriTs and relaxase operons were synthesized de novo and cloned into pCOLADuetTM-1 by GenScript USA Inc ...
-
bioRxiv - Biophysics 2022Quote: Plasmids were prepared by de novo synthesis by Genscript and codon optimized for expression in E ...
-
bioRxiv - Microbiology 2021Quote: ... which was synthesized de novo by GenScript (Nanjing, China). Distal LAMP1-Fc expressing plasmid was a gift from Professor Ron Diskin (Department of Structural Biology ...
-
bioRxiv - Microbiology 2023Quote: ... dermatitidis MRS4 alleles were synthesized de novo by Genscript with the omission of introns ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Genetics 2022Quote: ... The HaOatp74D (2136bp) ORF was synthesized de novo (Genscript, Piscataway, NJ) based on the alignment of both NCBI reference sequence and the de novo transcriptome assembly of H ...
-
bioRxiv - Cell Biology 2021Quote: ... ParBF1-42 and ParBF1-42 R36A were synthesized de novo (Genscript).
-
bioRxiv - Synthetic Biology 2022Quote: ... The entire pVANT sequence was synthesized de novo (GenScript, NJ, USA) and cloned into E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... synthesized de novo and subcloned in pGEMHE by GenScript (Piscataway, NJ). Complementary DNAs encoding human nAChR subunits were cloned in pSP64 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: The genes of miRFP720 and miRFP670nano were de novo synthesized by GenScript using sequences reported in the original publications19,40 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The gene for miRFP720-P2A-GFP was synthesized de novo by GenScript, based on the reported sequence13 ...
-
bioRxiv - Biophysics 2024Quote: ... pGEX-MgtA dimer (12mer) plasmids were de novo gene synthesized by GenScript. Plasmids created in this study were assembled using the Gibson Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Bioengineering 2024Quote: ... All constructs were synthesized de novo and subcloned by Genscript (Piscataway, NJ, USA) (SI Appendix ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-Cy5-ACGCGUCGCAGGCCU UUUUAUU-3’; 0.3 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: The mammalian codon-optimized genes of phiLOV2.1 and UnaG were synthesized de novo by GenScript based on the amino acid sequences reported in the original publications4,31 ...
-
bioRxiv - Neuroscience 2024Quote: ... UAS-KCR1-GS and UAS-WiChR transgenic lines were generated by de novo synthesis (Genscript) of Drosophila codon-optimized HcKCR insert sequences 43 (Genbank #MZ826861 and #MZ826862 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2024Quote: ... The following gRNA sequence targeting ATF3 was cloned into pLentiCRISPRv2 plasmid: 5’-CCACCGGATGTCCTCTGCGC-3’ (Genscript, Clone ID C88007). HEK 293FT cells were co-transfected with pLentiCRISPRv2-ATF3 CRISPR gRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... A backbone vector containing the 3’ and 5’ segments of the Kv1.2 gene (including the UTR regions) in pUC57-Kan was ordered from Genscript. The final constructs were assembled using golden-gate cloning(52) ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The resulting chimeric DNA sequence was flanked a 3’-BamHI and 5’-EcoRI sites and commercially synthesised (GenScript, Rijswijk, Netherlands) into vector pUC19 (pJGUC01) ...
-
bioRxiv - Microbiology 2022Quote: ... This codon-optimized version of dcas9 (Bbdcas9) was synthesized and cloned in pBluescript II KS (+) with flanking 5’ NdeI and 3’ NotI restriction endonuclease sites (GenScript), yielding pBS-Bbdcas9 ...
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...