Labshake search
Citations for GenScript :
1 - 50 of 136 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... alpha-factor peptide (GenScript) was added to a final concentration of 5 µg/ml for 1.5 hours ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... and then arrested in G1 with alpha-factor (GenScript (RP01002)– 10 mg/ml stock concentration and 10 µg/ml working concentration ...
-
bioRxiv - Molecular Biology 2022Quote: ... Arylphorin subunit alpha-like (Demetra) and hexamerin (Ceres) were produced by Genscript, utilizing the baculovirus expression system in insect cells ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were arrested in G1 with 100 ng ml-1 alpha factor (GenScript) and incubation was continued for 3 hours ...
-
bioRxiv - Genetics 2021Quote: ... Cultures were synchronized in G1 with 1.5 μg/ml alpha factor mating pheromone (GenScript) for 3 h at 30°C ...
-
bioRxiv - Cell Biology 2022Quote: ... MATα cells were verified by their lack of response to alpha factor (αF, Genscript) and by their ability to mate with MATa cells ...
-
bioRxiv - Biochemistry 2022Quote: ... The sequence encoding mouse alpha-DG N terminal domain(a-DGN) was synthesized (Genscript) and cloned into the AAV backbone under the transcriptional control of the ubiquitous CMV promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Immunology 2024Quote: ... G12V-TCR alpha chain (1-206) and G12V-TCR beta chain (1-246) were synthesized by Genscript (USA) and cloned into the pET30a+ vector ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1 ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg of DBR1 expression vector (GenScript, OHu11162) was transfected into cells using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ug protein samples were boiled at 90°C for 5 minutes in LDS sample buffer (Genscript#M00676 or Millipore#MPSB) containing 5% 2-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5× sample buffer (GenScript), heated to 100°C for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... Omicron BA.1 and BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Bioengineering 2022Quote: ... The rat Arc 5’ UTR sequence was synthesized by Genscript. Molecular cloning techniques (PCR amplification ...
-
bioRxiv - Biochemistry 2024Quote: hOrc1-5 expression plasmids were generated by gene synthesis (Genscript) based on pESC vectors (Stratagene ...
-
bioRxiv - Microbiology 2024Quote: ... A high purity Hst-5 peptide was synthesized by GenScript and Hst-5 specific rabbit polyclonal antibody was produced by Lampire Biological Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... All AtLEA4-5 Scrambled ORFs were synthesized as gene fragments (Genscript).
-
bioRxiv - Evolutionary Biology 2022Quote: Protein G (5 μg/ml, 50 μl/well; Genscript, China, Z02007) was diluted to 5 μg/ml with PBS (0.01 M ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), or 5 μl heat-killed bacteria in PBS ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Biochemistry 2024Quote: ... were coated with 20 µl 5 µg/mL Protein A (Genscript, Z02201) in 100 mM sodium bicarbonate pH 9.6 at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultures were blocked by addition of 5 μg/ml of α factor (GenScript) every 90 min in YPAD until <10% cells were budded ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of a synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), eBioscience Cell Stimulation Cocktail (Fisher Scientific 00-4975-93 ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... CENP-T was fluorescently labeled with a GGGGK-TMR (5-Carboxytetramethylrhodamine) peptide (GenScript) using the Calcium-independent Sortase 7M (Hirakawa et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the samples were boiled in 5 х Loading Buffer (GenScript, Piscataway, NJ, USA) and subjected to SDS-PAGE or immunoblotting with indicated antibody.