Labshake search
Citations for GenScript :
1 - 50 of 744 citations for 4 Chloro 2 methoxy N 2 4 methoxy phenyl ethyl benzamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Molecular Biology 2024Quote: sgRNAs with the modification of phosphorothioation and methoxy group were synthesized by GenScript (Nanjing, China) (Supplementary Sequence) ...
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biophysics 2024Quote: The sequence expressing SARS-CoV-2 N protein was obtained from Genscript inside Pet-28 plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Biochemistry 2020Quote: ... Rpc5-WH3/4 and Rpc5-WH1/4 from its genomic DNA (Genscript). The constructs were subsequently cloned into pOPINF or pOPINJ plasmids for bacterial expression or into pACEBac1 plasmid for baculovirus–insect cells expression ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Microbiology 2024Quote: ... followed by staining of cells with primary rabbit anti-SARS-CoV-2 N Wuhan-1 antibody (Genscript U739BGB150-5) (1:2000 dilution ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ BamHI) SARS-Cov-2 N gene (Gene ID: 43740575) in pET-11a vector without any affinity tag (GenScript). pET-11a expression vector carrying SARS-Cov-2 N gene was transformed in BL21 (DE3 ...
-
bioRxiv - Immunology 2021Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2022Quote: ... Peptide pools consisted of 15-mer peptides overlapped by 11 amino acids and spanning the entire S and N proteins of SARS-CoV-2 (GenScript). After stimulation ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 µL of SARS-CoV-2 RBD (1 µg/mL) (cat n° Z03479, GenScript, Piscataway, NJ, USA) and S1 subunit (0.5 µg/mL ...
-
Activation of endoplasmic reticulum stress via clustering of the inner nuclear membrane protein SUN2bioRxiv - Cell Biology 2022Quote: ... and SUN2-N-2 (AA 1-226) fragments by PCR from pcDNA3.1+/C-(K)DY-SUN2 vector (OHu01874,GenScript # NM_001199579.1) and subsequent cloning into MP029-CRY2-mCherry lentiviral vector using the NheI/XbaI restriction sites ...
-
bioRxiv - Immunology 2020Quote: A full-length nucleocapsid (N) phosphoprotein nucleotide sequence (1293 base-pairs) of the SARS-CoV-2 virus was optimized and synthesized (Genscript). The synthesized sequence was cloned into a PET-30a(+ ...
-
bioRxiv - Microbiology 2022Quote: ... were stimulated for 24 h with 15-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat no# PM-WCPV-S-1, JPT Peptide Technologies GmbH) or VSV-N (Genscript) at a concentration of 2.5 µg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1 encoding CoV-2 Omicron (BA.1) Spike tagged with a His epitope on the N-terminus was synthesized provided by Genscript. pMD2.G encoding VSV-G (12259 ...
-
bioRxiv - Microbiology 2024Quote: Plasmids encoding full-length or truncated proteins from SARS-COV-2 (clinical isolate Australia/VIC01/2020) tagged at the N-terminus with eGFP were generated by GenScript in pcDNA 3.1-N-eGFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slot-RL and the recoded versions of pEGFP (pEGFP-1, EGFP-2), pRL (pRL1, pRL2 and pRL3) and N (p5’L-N1, pN1) were obtained from GenScript.
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS-CoV-2 pseudovirus (Genscript) was diluted in DMEM complete media to an IFU of 3.2e7/mL ...