Labshake search
Citations for GenScript :
1 - 50 of 342 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the commercialized ELISA kit (Genscript, Cat#L00871) was used ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Immunology 2019Quote: 96-well ELISA plates were coated overnight at 4°C with mouse anti-Avi-tag antibody (Genscript) at 2 μg/ml in PBS ...
-
bioRxiv - Immunology 2021Quote: Competitive inhibition ELISA was performed using SARS-CoV-2 neutralization antibody detection kit (Genscript). The kit detects circulating neutralizing antibodies against SARS-CoV-2 that block the interaction between the receptor binding domains of the viral spike glycoprotein (RBD ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The His-tagged GMCSF peptide was quantified using a His Tag ELISA Detection Kit (GenScript) according to the provided protocol and 5-10 fold dilutions of frozen samples.
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... immunized animal sera were tested by indirect ELISA and competitive ELISA for immune response by GenScript. Western Blot evaluation of pre-sera and sera after 3rd immunization against 200 ng of purified protein/lane using a 1:1000 dilution was performed in-house as described ...
-
bioRxiv - Immunology 2020Quote: ... at 95°C for 5 min and then separated using ExpressPlus PAGE Gels 4-20% (GenScript). Proteins were transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Bioengineering 2023Quote: ... mAb was preferred for ELISA (GenScript, Cat.#A01854). For western blotting ...
-
bioRxiv - Cell Biology 2019Quote: IL-6 concentrations in the cell supernatant were were detected utilizing mouse IL -6 ELISA kit t (A015171517) purchased from GenScript Biological Technology Co.Ltd ...
-
bioRxiv - Synthetic Biology 2023Quote: The expression levels of his-tagged nanobodies resulting from microfermentations were quantified using the His tag ELISA detection kit (GenScript, Cat# L00436) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Immunology 2021Quote: ... preliminary ELISA screening and production of hybridomas were performed by Genscript as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... and tested for affinity with ELISA and Western blot by Genscript.
-
bioRxiv - Cell Biology 2019Quote: ... 20 µg of 30-mer oligo(dT) labeled with an NH2 group at its 5’-end (synthesized by Genscript, Nanjing, China) and 50 µg of Alexa Fluor 647 NHS ester (A37537 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... sgRNA template sequences of the format: 5′-GGAGAACCACCTTGTTGG-(N)20-GTTTAAGAGCTAAGCTGGAAAC-3′ were synthesized in a pooled format on microarray surfaces (GenScript Biotech, Inc.). Oligo pools were PCR-amplified using Phusion Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Phospho-peptides conjugated to biotin for ELISA assay were synthesized by GenScript (Hong Kong). Antibodies against the IR β-subunit (sc-57342 ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... BDNF 20 ng/mL (GenScript), GDNF 20 ng/mL (GenScript) ...
-
bioRxiv - Neuroscience 2023Quote: ... GDNF 20 ng/mL (GenScript), 200 μМ ascorbic acid (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... or TNFα (GenScript, Z02774-20). Human GF was treated with five cholesterol-lowering drugs (fenofibrate ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 μg of total protein was separated by SDS– PAGE on 4-20% gradient ExpressPlus PAGE M42015 (GenScript) and transferred onto PVDF membranes using iBlot™ 2 Gel Transfer Device (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs of GALNTs 1-20 (Genscript) were amplified by PCR and digested by BamHI and NotI (GALNT1 ...
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 20-minute washes with 33 ul of GluA1 peptide (20 ug/ul) representing the antibody epitope (GenScript Biotech, Piscataway, NJ). ATVs were then immediately used and continually stored on ice at 4 °C.
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Biochemistry 2020Quote: ... two stable sub-clonal cell lines of each parental clone were chosen for cryopreservation based on the result of ELISA (GenScript). Positive cell supernatants were evaluated by WB against 200 ng of purified protein/lane using a 1:10 dilution in-house as described ...
-
bioRxiv - Biophysics 2021Quote: ... 20 mg/mL Nb35 and 10 μM peptide (GenScript). The lysate was incubated for 1.5 h at room temperature (RT ...
-
bioRxiv - Immunology 2021Quote: Vaccine-elicited anti-SARS-CoV-2 antibody responses were quantified using the GenScript SARS-CoV-2 Neutralization sVNT cPASS TM Kit (GenScript Catalog #L00847-5), which effectively measures the ability of patient plasma to block the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA (5’-UCGCUUGGUGCAGAUCGGGAC-3’) labeled at the 5’ end with FAM was synthesized by Genscript co. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The bioluminescence detection signal was measured for each design lucCage at 20 nM mixed with lucKey at 20 nM in the presence or absence of 100 nM cardiac Troponin I (Genscript, Cat. No. Z03320-50). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... Immunoblotting was performed as reported (20) using anti-His (GenScript) or anti-carrot FBA (14 ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.