Labshake search
Citations for GenScript :
451 - 500 of 511 citations for 1 6 Bismaleimidoethane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... at C-terminal was cloned into pGEX-6P-1 vector at BamHI and XhoI sites using gene synthesis and cloning services (GenScript, USA). The plasmid was transformed into E ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... consensus sequence was obtained from RepeatMasker and/or from repbase (http://www.repeatmasker.org/) synthetized and cloned into pUC57 by GenScript (Supplementary Table 1). To make the IAPEz reporter (pTCH1) ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Cell Biology 2021Quote: ... were transfected with individual shRNA in pLKO.1 (Broad Institute, Cambridge, MA) mixed with packaging plasmid pCMV-dR8.91 (G193486, GenScript, Piscataway, NJ) and envelope plasmid pVSV-G (G178153 ...
-
bioRxiv - Immunology 2021Quote: ... and beta (1-244) chains were synthesized and cloned into the bacterial expression vector pET30a via NdeI and XhoI (Genscript, USA). Proteins were expressed as inclusion bodies in BL21 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2021Quote: ... The wells were washed six times with PBS-T and incubated with 100 µL (1:10000) of Goat Anti Mouse IgG (Genscript, USA) or Anti Hamster IgG (Abcam ...
-
bioRxiv - Plant Biology 2020Quote: ... 1.5 μg of MEA or 1.5 μg of CLF (PRC2) complexes were incubated with 1 μg of Histone H3 peptides (GenScript, Piscataway, NJ) and 1.5 μCi of 3H-SAM (Perkin Elmer ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:5,000 dilution) overnight at 4⍰°C followed by 11h incubation with anti-rabbit IgG secondary antibody (Genscript, catalog number. A00098) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lamin-C was overproduced and purified from codon-optimized Lamin-C (amino acid residues 1-152) engineered into pRSF-Duet plasmid (Genscript Inc.). The construct carries a tandem N-terminal Strep-tag ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mammalian plasmid pcDNA3.1(+)-pHluorin was made by synthesizing and cloning a codon optimized sequence of pHluorin into the pcDNA3.1(+) backbone (GenScript; Piscataway, NJ).
-
bioRxiv - Biochemistry 2022Quote: ... The gene sequences for the PDZ domain of human PDLIM7 (1-84) and various point mutants were synthesised as codon optimised constructs and cloned into pET30b(+) by Genscript (USA) for bacterial expression with an N-terminal 6His-tag.
-
bioRxiv - Cancer Biology 2022Quote: ... SdAb detection was performed using (1:20000) MonoRab™ Rabbit Anti-Camelid VHH Antibody conjugated to HRP (GenScript, Cat. # A01861-200) in MTBST 0.05% ...
-
bioRxiv - Microbiology 2022Quote: ... the chromatography column was resuspended with 1 ml TCB as well as 20 μl (200 U) of TE protease enzyme (Genscript, Inc) on a rotator and the columns incubated at 4°C for 16 hours ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 full-length N gene of Wuhan-hu-1 isolate (GenBank # NC 045512.2) was synthesized (GenScript, Piscataway, NJ) and cloned in the pET-28a (+ ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cultures were diluted 50-fold by transfer to 200 µL volumes comprising a 10-fold dilution series of ɑ-factor (0- 1 µM) (GenScript) in SC+1%DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... The solution was replaced with blocking buffer with appropriate dilutions of primary antibody (1:500 Rabbit anti-ChmC (Genscript, custom-generated) or 1:2,000 Rabbit anti-OmpA ...
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fusion protein MBP-Hyx 1-176 was purified and injected into guinea pigs and the antibodies generated were purified by GenScript (Hong Kong).
-
bioRxiv - Immunology 2019Quote: Peptides (Table 1) and HLA-A*11:01-restricted KRAS G12V8-16 (VVGAVGVGK) as positive peptide were synthesized from GenScript (Nanjing, China), with purity greater than 98% by mass spectroscopy ...
-
bioRxiv - Biophysics 2019Quote: ... or s-(residues 195-960) OPA1 (UniProt O60313-1) were codon optimized for expression in Pichia pastoris and synthesized by GenScript (NJ, USA). The sequences encode Twin-Strep-tag ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biophysics 2021Quote: ... Human l-Opa1 (isoform 1) and s-Opa1 with Twin-strep-tag at N-terminus and deca-histindine tag at C-terminus (GenScript, NJ, USA) was expressed in Pichia pastoris strain SMD1163 ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was run on separate 12% SDS–polyacrylamide gel and probed using βarr antibody and HRP-coupled protein L antibody (dilution-1:2,000; GenScript; cat. No. M00098) by western blotting ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Cell Biology 2019Quote: Protease-activated receptor 1 (PAR-1)-activating peptide (TFLLRNPNDK-NH2) was custom synthesized as the C-terminal amide with a purity of > 95% by Genscript (Piscataway, NJ). Scrambled-siRNA (Sc-siRNA ...
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Microbiology 2020Quote: A synthetic gene encoding an human ACE2 fragment (residues 1-615) fused with a C-terminal 6xHis tag was generated by GenScript (Piscataway, NJ) and cloned into pCMV-IRES-puro expression vector (Codex BioSolutions ...
-
bioRxiv - Microbiology 2021Quote: ... of the SARS CoV2 isolate Wuhan-hu-1 genome (Genbank: NC_045512) were commercially synthesized and cloned into pUC57 vector (Genscript, New Jersey, USA). RNA motif plasmid cloning backbone [(pRMB ...
-
bioRxiv - Biochemistry 2022Quote: ... or by adding 200 ng/well of monovalent or bivalent cAbCMY-2 (254) recognized by 1/2000 diluted rabbit anti-HCAbs antibody conjugated to HRP (Genscript, United States). TMB was used as substrate while reaction was stopped by 1 M H3PO4 ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript; 1:1000 dilution). The secondary antibodies were mouse IgG HRP-linked (NA931 ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... A synthetic standard containing base positions 1-200 from the 16S rRNA gene sequence was used for the standard curve (GenScript, Rijswijk, Netherlands). The qPCR was carried out on a Strategene Mx3005P qPCR machine (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... the membranes were incubated overnight at 4°C with anti-zebrafish Ybx1 primary antibody we prepared previously (1:2000) (GenScript, Nanjing, China) (26) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 × 106 splenocytes were plated into each well of a 96-well flat-bottom plate and either left untreated or treated with 1 ug/ml p56 (AGPHNDMEI) or p79 (TSINFVKI) peptides (Genscript, Piscataway, NJ) for 5 h at 37°C in the presence of Brefeldin A (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... mice were intravenously injected with 0.1 mg (from a solution of 1mg/ml in PBS) of VP2121-130 (FHAGSLLVFM) or control E7 (RAHYNIVTF) peptide (GenScript, Piscataway, NJ, USA) into the tail vein.
-
bioRxiv - Microbiology 2021Quote: The cyc2 gene of Mariprofundus ferrooxydans PV-1 (accession no. AKN78226) was codon-optimized for expression in Escherichia coli and synthesized by Genscript (Piscataway, NJ, USA) with a C-terminal Strep-tag II (WSHPQFEK ...
-
bioRxiv - Immunology 2020Quote: ... was added to the wells and incubated at room temperature for 2 hours and the binding was detected by adding 100 μL 1:10,000 diluted HRP conjugated anti-human IgG antibodies (GenScript, Piscataway, USA; Cat# A00166) with a 1-hour incubation period at room temperature ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The solubilized membrane-fraction was loaded on a column containing 1 mL anti-DYKDDDDK (Flag) G1 affinity resin (50% suspension; GenScript, Piscataway, NJ, USA) pre-equilibrated with 3 bed volumes of TBS buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... nucleotides 1–468) and C-terminal (VC; nucleotides 469–724) fragments of the Venus I152L variant 54 were synthetized by GenScript (Piscataway, NJ, USA). In all cases a CAT codon coding for an extra Histidine residue was added to the sequences after the first ATG start codon in order to generate NsiI restriction sites (ATGCAT ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...