Labshake search
Citations for GenScript :
1 - 50 of 1114 citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... or 4 μg BMP-2 (Genscript, Piscataway, NJ) per mg GMs ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Biochemistry 2022Quote: ... middle and bottom of the gradient were collected and 15 μL of each were mixed with 4 μL 4x loading buffer and heated for 3 mins before SDS-PAGE gel electrophoresis (SurePAGE 10% Bis-Tris, GenScript).
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Cell Biology 2021Quote: ... Three human codon-optimized As-NF-κB (named 1, 2, and 3) cDNAs were synthesized by GenScript based on sequences from the transcriptome of A ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated on 4-12% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript M00138 ...
-
bioRxiv - Biochemistry 2020Quote: 2 µg GST (GenScript; Cat. # Z02039-1), ubiquitin (R&D Systems ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... and resolved on a 4-12% Bis-Tris polyacrylamide gradient gel (Genscript). Proteins were transferred to PVDF membranes and immunodetection of respiratory chain complexes was performed using the Total OXPHOS Blue Native WB Antibody Cocktail (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Using SurePAGE 4-12% bis-tris gels (GenScript, Piscataway, NJ; cat # M00653), 40μl of protein sample was loaded into each well and run at 200V for roughly 1.5 hours in Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Biochemistry 2022Quote: ... using SurePAGE 4-20% gradient Bis-Tris gels (Genscript, Picastaway, NJ, USA) under reducing conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were loaded on Bis-Tris gradient gels (4-20%, Genscript) and run using Tris-MOPS buffer at 60 mA/200 V ...
-
bioRxiv - Cancer Biology 2024Quote: Gene blocks containing three fragments of the long isoform of NAB2-STAT6 (exons 1-4 of NAB2 and exons 2-22 of STAT6) with a c-terminal FLAG tag were ordered from GenScript. Using Gibson Assembly® Master Mix (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Human MARCH2 isoform 2 was identified from https://www.uniprot.org/uniprotkb/Q9P0N8/entry#Q9P0N8-1/2 and was acquired from GenScript, (clone ID ...
-
bioRxiv - Microbiology 2020Quote: ... were coated overnight at 4°C with 2μg/ml of recombinant SARS-CoV-2 S1-RBD protein (GenScript No. Z03483-1) in carbonate-bicarbonate buffer (Sigma Aldrich No ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mixture was resolved on a 4-20% Bis-Tris gel (Genscript) and visualized by Coomassie staining.
-
bioRxiv - Biochemistry 2021Quote: BiP-binding sites 1 and 3 were synthesized by Alan Scientific (Gaithersburg, MD) and site 2 was synthesized by Genscript (Piscataway, NJ). All peptides are N-terminally labeled with FITC via an amino hexanoic acid linker ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of lysate was then separated by SDS-PAGE and ERK1/2 bands were detected by Western blotting using corresponding antibodies (rabbit phospho-ERK1/2 antibody, 1:5000 dilution; rabbit total ERK1/2 antibody, 1:5000 dilution; anti-rabbit HRP-coupled secondary antibody, Genscript, Cat. No. A00098, 1:10000 dilution). ECL solution from Promega (Cat ...
-
bioRxiv - Genetics 2023Quote: ... The Klf2 genomic fragment from intron 2 to the exon 3 untranslated region was synthesized (GenScript) and cloned into the HindIII-SbfI site of pPGKneo-F2F-Klf2-5HR located at the opposite side of the NotI site with respect to the neo cassette ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Biophysics 2021Quote: ... The samples were then loaded onto a SurePAGE gel (4-20% Bis-Tris)(Genscript). Substrate protein bands were detected by Coomassie Blue staining.
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... samples were boiled then run on Surepage 4-12% Bis-Tris gels (#M00653, GenScript). Samples were then transferred onto 0.45 um nitrocellulose membranes in Tris-Glycine transfer buffer (25 mM Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... Equal amount of total protein (typically 20 or 30 µg/sample) were separated either on 4-12% or 4-20% SurePAGE Bis-Tris gels (Genscript) and transferred on nitrocellulose membrane (Merck Millipore ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Immunology 2022Quote: ... The samples were then run on the Bolt 4–20% Bis-Tris Plus Gel (GenScript) and western blot was performed ...
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total cellular proteins were separated in 4-12% YoungPAGE Bis-Tris gels (GenScript, Nanjing, China) or 10% gels using One-Step PAGE Gel Fast Preparation Kit (Vazyme) ...
-
bioRxiv - Biochemistry 2024Quote: Pull down samples were then run on a 4-12% Bis-Tris denaturing gel (GenScript), then analyzed by Western blotting ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Neuroscience 2024Quote: ... and FAT-2 (Genscript) cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215 ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Biochemistry 2020Quote: ... of SARS-CoV-2 (D614) and the ectodomain of human angiotensin converting enzyme 2 (ACE2; residue 1-615) were synthesized by GenScript (Piscataway, NJ). The S gene was fused with a C-terminal twin Strep tag [(GGGGS)2WSHPQFEK(GGGGS)2WSHPQFEK)] and cloned into a mammalian cell expression vector pCMV-IRES-puro (Codex BioSolutions ...
-
bioRxiv - Microbiology 2023Quote: ... BA.2 and BA.4/5 lacking the C-terminal 19 codons (SΔ19) was synthesized by GenScript. The SΔ19 gene of BA.2.75 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2021Quote: The ability of aptamers to block the association of SARS-COV-2 RBD with ACE-2 was measured with the cPass™ SARS-CoV-2 Neutralization Antibody Detection kit (GenScript®). For comparison ...
-
bioRxiv - Cell Biology 2021Quote: ... and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656, GenScript). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (1620145 ...
-
bioRxiv - Immunology 2020Quote: ... concentrated and evaluated by SDS-PAGE using 4 –12% Bis–Tris Novex gels (GenScript catalog #M00652) under reducing and non-reducing conditions followed by a Coomassie blue staining (Expedeon ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μL of each sample was loaded in a 4-12% Bis-Tris SurePAGE gel (GenScript) using MOPS running buffer and then transferred onto a PVDF membrane (Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were loaded onto three independent SurePAGE Bis-Tris 10x8 4-12% gels (Genscript M00652) and run at 150 V for approximately one hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...