Labshake search
Citations for GenScript :
401 - 450 of 1136 citations for Tumor Necrosis Factor Alpha Induced Protein 2 TNFAIP2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Plant Biology 2024Quote: ... then proteins were purified using Ni–Charged Resin (GenScript, Cat. No. L00223). The bands of NopTP and NopT ...
-
bioRxiv - Plant Biology 2024Quote: ... coli followed by protein purification using Glutathione Resin (GenScript, Cat. No. L00206). About 80μg cleaved NFR5 was collected for analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of 100 ng/µL Cas9 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per egg 2 nL was injected ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two replicates for each antibody (LY-CoV016, LY-CoV555, REGN10987, and S309 [Genscript, Gene-to-Antibody service]) assay on different days ...
-
bioRxiv - Bioengineering 2022Quote: ... A mouse anti-His-Tag antibody (GenScript) was diluted 1:100 and used as the primary antibody ...
-
bioRxiv - Microbiology 2020Quote: Custom rabbit polyclonal antibodies (GenScript, Nanjing, China) raised against tryptic peptides of Mtb EsxN (AQAASLEAEHQAIVR ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (Starr et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (25 ...
-
bioRxiv - Cell Biology 2020Quote: ... Coronin peptide antibody was generated by GenScript as peptide-KLH conjugation in New Zealand rabbits (sequence in Table 3) ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-Loqs antibody (custom generated by GenScript), Anti-HA antibody (ab130275 ...
-
bioRxiv - Immunology 2020Quote: ... and the CD3/CD4 bispecific antibody (Genscript) to expand CD8 T-cells ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Cell Biology 2023Quote: ... immunoblotted with antibodies (anti-GFP from Genscript, anti-DYKDDDK from Genscript ...
-
bioRxiv - Neuroscience 2023Quote: ... IP/Western blot antibodies were rabbit anti-Xenopus laevis CD2AP polyclonal affinity purified antibody raised against the peptide CRPKSEVEPHSKTKT custom made by GenScript and anti-Xenopus laevis FOLR1 antibody (GenScript). After washing steps ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
CRISPR-Cas9 Engineered Extracellular Vesicles for the Treatment of Dominant Progressive Hearing LossbioRxiv - Bioengineering 2023Quote: ... anti-Cas9 antibody (Genscript, Cat# A01935, USA) 1% BSA mixture overnight at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... using anti-His (mouse) primary antibody (GenScript) at a dilution of 1:3,000 ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The secondary antibody solution consisted of MonoRab ™: Rabbit Anti-Camelid VHH Antibody [HRP] mAb (GenScript, Cat. # A01861-200) (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were then incubated with antibody (anti-Myc antibody 9E10 or anti-CycB3, from rabbit, custom-made by Genscript) for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transferred membranes were incubated with the following primary antibodies overnight at 4°C: DUXBL (1:1000, Custom antibody, GenScript), ZSCAN4C (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The next morning the buffer was replaced with 10 ml new TBST (2.5% milk) and primary antibody added (polyclonal rabbit antibodies ordered from GenScript). The antibody used for each blot is indicated in the figure ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times with goat anti-rabbit IgG antibody or goat anti-mouse IgG antibody (GenScript) for one hour followed by washing three times with TBST again ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...
-
bioRxiv - Molecular Biology 2023Quote: ... The bound proteins were eluted with Flag peptide (200 μg/ml; GenScript, RP10586) in thermomixer at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... This clarified protein lysate was then shaken with Ni-charged IMAC Magbeads (Genscript) for 1 hour to bind tagged proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant BRD4 N-terminal protein was purchased from GenScript (BRD4-N (49-460aa), His ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 µg of protein was loaded onto a 10% SurePAGE polyacrylamide gel (Genscript) and resolved for 1 cm ...
-
bioRxiv - Microbiology 2019Quote: ... the dissected thrips tissues that were only incubated with secondary antibody (without adding primary antibody) and the tissues incubated with each pre-immune mouse antiserum (GenScript) were used as negative controls ...
-
bioRxiv - Immunology 2023Quote: The antibody heavy chain genes of matured AIIMS-P01 lineage antibody was synthesized after codon-optimization for mammalian expression from Genscript, Inc ...