Labshake search
Citations for GenScript :
401 - 450 of 1047 citations for Respiratory syncytial virus RSV fusion protein exodomain human heterodimeric IgG1 Fc tag recombinant antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Sic1PY and WW-HECT were purified as previously described10. Human UBE1 (plasmid obtained as a gift from C. Tang, Peking University) and human UBCH5A (obtained from GenScript, China) were expressed as GST fusion proteins from pGEX-4T vectors ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purification was performed with Protein A magnetic beads (GenScript, L00695). The purified mAbs were dialyzed against phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Cancer Biology 2021Quote: The human FOXA1 sequence with RefSeq accession ID NM_004496 was synthesized with a C-terminal V5-tag sequence and obtained in pCIneo vector with NheI and XhoI cloning sites from GenScript. The sequence with the C-terminal V5-tag was transferred to the pEF1neo mammalian expression vector using NheI and SalI ...
-
bioRxiv - Genetics 2021Quote: ... This construct with a C-terminal 3x HA epitope tag was generated and subcloned into pUASTattB by Genscript (NJ, USA). Transgenic flies were generated by Genetivision (Houston ...
-
bioRxiv - Biochemistry 2022Quote: Recombinant mEAK-7 from Sus scrofa (uniprot ID: A0A4X1T484) was synthesized in a pET28 vector with N-terminal 6×His tag (GenScript). ArcticExpress competent cells (Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Genomics 2020Quote: ... Lines were then analyzed for TALE expression by western blot using an anti HA-tag antibody (Genscript Cat# A00168-40).
-
bioRxiv - Microbiology 2019Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Molecular Biology 2019Quote: Purified ERα LBD containing amino acids 315-545 used by Brzozowski et al for crystallization16 with a his-tag was custom made (GenScript). All reactions were set up in 20 μL reactions in 96 well plates with purified ERα LBD at a concentration of 0.6 μg/μL and 10x SPYRO orange dye (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: The full-length human NatD gene was amplified and cloned into a modified pET-21a(+) vector containing an 8x-His-tag and SUMO protease cleavage site at the N-terminus (Genscript). This pET-21a(+)-hNatD construct was transformed into Escherichia coli BL21 (DE3 ...
-
bioRxiv - Biophysics 2021Quote: ... lacking its amino-terminally signaling sequence within a pET28b-vector backbone yielding DegP with an amino-terminal His6-Tag (purchased from GenScript). The individual PDZ domains ...
-
bioRxiv - Biochemistry 2022Quote: The gene encoding SARS-CoV-2 NSP3 Mac1 (residues 3-169) was cloned into a pET-22b(+) expression plasmid with a TEV-cleavable N-terminal 6-His tag (Genscript). The protein was expressed and purified as described previously (14).
-
bioRxiv - Microbiology 2020Quote: The I53-50B.4PT1 was codon-optimized and synthesized and then cloned into a modified pET28a* vector with a C-terminal hexahistidine tag by Genscript.
-
bioRxiv - Cancer Biology 2021Quote: ... we first synthesized a cassette coding the FKBP-derived destabilization domain (DD)33 along with an EcoRI restriction site and a single FLAG tag (Genscript). This cassette was then cloned into pHIV-NAT-T2A-hCD52 (kind gift of R ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... synthesized and subcloned into the pET28a(+) vector with restriction cleavage by NdeI/XhoI to carry both N- and C-terminal His6 tags (Genscript). Primers carrying a G155A or G225V mutation were designed for site-directed mutagenesis using a Q5® Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The SARS-CoV-2 sp12 gene was codon optimized and cloned into pFastBac with C-terminal additions of a TEV site and strep tag (Genscript). The pFastBac plasmid and DH10Bac E ...
-
bioRxiv - Biochemistry 2019Quote: ... A peptide corresponding to residues 129-165 of RILPL2 was synthesized with an N-terminal hexahistidine tag (His6-RILPL2, Genscript). The peptide was solubilized in matching buffer with Rab (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2020Quote: ... followed by a TEV cleavage site and a hexahistidine-tag was cloned between NdeI and BamHI restriction sites of a pET-11a vector by Genscript with a codon optimization ...
-
bioRxiv - Plant Biology 2020Quote: ... coli codon-optimized gene for Arabidopsis UVR8 was introduced into the pET11a expression vector generating a construct carrying an N-terminal 6×His-tag (Genscript). The construct was verified by DNA-sequencing and transformed into the E ...
-
bioRxiv - Cell Biology 2020Quote: Arhgef11CA with a membrane targeting domain and an HA tag with a stop code on the C-terminal was synthesized by GenScript. NheI and Sal I sites were inserted on the 5’ and 3’ ends of the Arhgef11CA cassette ...
-
bioRxiv - Biochemistry 2021Quote: ... was cloned into the pGEX-6P-1 plasmid with an N-terminal GST tag and precision protease cleavage site after codon optimization by DAPCEL and synthesis by GenScript. The plasmid was then transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... cholerae biovar El Tor strain N16961 (NCBI NC_002506.1) fused to a histidine-tag coding strip placed C-terminal to parE2 was synthesized by Genscript (https://www.genscript.com/). This gene was subsequently cloned into the NcoI-NheI sites of a pET28a plasmid and verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biochemistry 2022Quote: cDNA encoding His6-TEV-pro-conA sequence was synthesized and sub-cloned into pET28a(+) in framed with the N-terminal His-tag (Genscript), followed by transformation into Rosetta PLysS competent cells (Novagen) ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Microbiology 2023Quote: ... The plasmid encoding Wag31 with an N-terminal 6xHis tag followed by a TEV protease cleavage site (pET-His-TEV-Wag31) was synthesized by Genscript. The Wag31 N-terminal DivIVA domain (Wag311-61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or vector containing full-length METTL7A or METTL7B with a C-terminus FLAG tag (all vectors from Genscript, Piscataway, NJ) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... NM_003755) with an N-terminal His6 tag was made by inserting DNA between NdeI and XhoI sites of pET15b (GenScript). pET15b-His6-eIF3g was used by GenScript to generate the deletion and substitution mutants.
-
bioRxiv - Biochemistry 2023Quote: ... vector encoding WT DosS CA (amino acids 454 – 578 of full-length DosS) sequence with an N-terminal 6xHis tag and a TEV protease site was purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous papers.22 The forward and reverse primers (5’ to 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Biophysics 2023Quote: The plasmids for the expression of codon optimized versions of G4Ps and variants with N-terminal FLAG-His tags in the pET28a backbone were synthesized by GenScript.
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: The recombinant PLpro wild type and mutants’ genes with an N-terminal Hisx6 tag was introduced into the pET-28b (+) bacterial expression vector by GenScript, Inc ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...