Labshake search
Citations for GenScript :
401 - 450 of 972 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 0.5 mg/mL Protein C peptide (GenScript), and 100 nM SE001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PAGE-MASTER Protein Standard Plus (GenScript), 5 μL in both cases ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli protein expression and synthesized by GenScript, USA before being cloned into the pETDuet-1 vector ...
-
bioRxiv - Immunology 2023Quote: All proteins were custom-made by GenScript HK Limited ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids pML107 11 or PAEF5 12 carrying gRNA were co-transformed with 200bp DNA repair recombinant donor sequences carrying telomeric repeats seeds (Genscript Biotech Netherlands) (Figure Supp 1A).
-
bioRxiv - Microbiology 2024Quote: Natural IgM and IgG were purified from normal murine serum using Protein G and Protein L resin (GenScript, China) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... Cdc42 and WAS-GBD were human codon-optimized and gene-synthesized by Genscript and inserted into the pCAGGS plasmid using an NEBuilder assembly kit ...
-
bioRxiv - Biophysics 2024Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cloning: Human KRAS-4B ORF (NCBI Reference Sequence NP_004976.2) was synthesized by GenScript and cloned into pUC57 ...
-
bioRxiv - Biochemistry 2020Quote: ... BG505 SOSIP.v4.1 expression constructs in which all PNGS were mutated to either NxT (NxT protein) or NxS (NxS protein) were obtained from Genscript and cloned in the pPPI4 expression vector ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Immunology 2024Quote: ... 293F cells were transfected with plasmids containing Spike protein (ATUM plasmid pD2528-CMV with insert QHD43416.1) and Spike-2P protein (site-directed mutagenesis to generate the 2P mutation on the plasmid containing Spike protein, GenScript) by 293fectinTM transfection reagent (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... anti-Protein C tag-171Yb (clone HPC4, Genscript), anti-mCherry-142Nd (Abcam) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.2 mg/mL Protein C peptide (Genscript), and concentrated on a Vivaspin 50-kDa concentrator.
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Microbiology 2021Quote: ... eBlot L1 –Fast Wet Protein Transfer System (GenScript) was used for blotting and proteins were stained using the following antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membrane (Genscript) by the Genscript eBLOT L1 fast wet protein transfer system ...
-
bioRxiv - Microbiology 2020Quote: ... The protein was cleaved using bovine enterokinase (GenScript) leaving a FLAG-tag at the C-terminus of the RBD ...
-
bioRxiv - Immunology 2022Quote: ... or S-protein peptide pool (Genscript, # RP30020, USA) or S-protein (B.1.351 ...
-
bioRxiv - Biochemistry 2023Quote: ... before incubation with Protein A Resin (Genscript, China) at room temperature for 2 h for antibody affinity purification ...
-
bioRxiv - Biochemistry 2024Quote: Plasmids for protein expression were ordered from Genscript (gene synthesis ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on 4%-12% (GenScript, M00654) or 4%-20% (GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... or rabbit anti-protein C (1:3000, GenScript) as primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Protein C (mouse, Genscript, A01774, 1:1000), anti-α-tubulin (mouse ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 Spike RBD protein (GenScript #Z03479) was immobilized on high-absorbency 96-well plates at 5 ng/mL and incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... Protein A/G beads (Genscript, Nanjing, Jiangsu, China) were subsequently added to the mixtures and incubated for another 5 h ...
-
bioRxiv - Biochemistry 2024Quote: ... The eluted protein was cleaved with PreScission (GenScript) protease by dialysis and run over a second glutathione affinity column ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... The total natural IgM was purified from the flow through serum from Protein G resin using Protein L resin (GenScript, China).
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeANXA4: Human ANXA4 (NM_001320698.2) in pcDNA3.1+/C-(K)-DYK vector was purchased from GenScript (GenScript Biotech ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Cell Biology 2021Quote: ... Cas9 protein was purchased from Genscript (Cat. No. Z03389). Cas9 protein (12 µg ...