Labshake search
Citations for GenScript :
401 - 450 of 1281 citations for Recombinant Human Catenin cadherin associated protein Beta 1 88kDa His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and AALA mutant were produced as GST-fused proteins by cloning the encoding ORF sequences into the pGEX-6P-1 plasmid (GenScript).
-
bioRxiv - Microbiology 2021Quote: ... Recombinant baculoviruses that express the N1-BR18 rNAs (see Fig. 1B for the rNA construct design) were produced by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were dried down under a stream of nitrogen at 42°C and treated with recombinant ceramide glycanase (rEGCase; GenScript) to release ceramide-linked glucosylceramide derived GSL oligosaccharides ...
-
bioRxiv - Immunology 2022Quote: ... Matched pairs of antibody VH and Vλ/Vκ sequences were commercially cloned into plasmids containing an IgG1 or relevant light chain backbone and expressed as recombinant antibody (Genscript). mAbs were also expressed in-house by transient transfection of Expi293 cells (Gibco ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... the GSL fractions were dried down under a stream of nitrogen at 42°C and digested with recombinant endoglycoceramidase (rEGCase I, prepared by Genscript) to release the oligosaccharide headgroups ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Molecular Biology 2022Quote: ... and recombinant mouse IL11 (rmIL11, UniProtKB: P47873) were synthesized without the signal peptide using a mammalian expression system by Genscript.
-
bioRxiv - Immunology 2023Quote: ... LY-CoV-1404/bebtelovimab antibody variable domain sequences were acquired from the structure reported in (45) and recombinant antibody was cloned and produced by Genscript. mAbs or ACE2 protein were first biotinylated using the EZ-Link Sulfo-NHS-Biotinylation Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Biochemistry 2023Quote: The Chinese hamster ovary (CHO-K1) cell line producing a recombinant mAb biosimilar of Trastuzumab was kindly donated by GenScript Biotech Corporation (Piscataway ...
-
bioRxiv - Immunology 2024Quote: ... T2A sequence and an anti-CD19 single-chain variable fragment (scFv) fused to 4-1BB and CD3ζ stimulatory endodomains (for TRAC-CAR19-KI) were subcloned into recombinant AAV6 plasmids (GenScript). DNA sequences were flanked with 400 base-pair homology arms immediately upstream and downstream of the TET2 gRNA or TRAC gRNA cut sites ...
-
bioRxiv - Cell Biology 2021Quote: Human SNX1 and SNX2 peptide sequences were synthesized by Genscript (USA). To obtain the peptide stock solutions at neutral pH ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized genes encoding for human PMCA1d and PMCA2w/a (Genscript) were cloned into pEMBL-yex4 expression plasmids by homologous recombination in S ...
-
bioRxiv - Immunology 2022Quote: ... BMDC were pulsed with 10 uM human gp10025-33 peptide (GenScript) in Opti-MEM medium (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: Human NaV1.2-3xFLAG IRES eGFP was generated by Genscript (Piscataway, NJ) by the addition of a short linker (AAARG ...
-
bioRxiv - Microbiology 2021Quote: The cDNAs encoding human or mink ACE2 were synthesized by GenScript and cloned into pLVX-IRES-zsGreen1 vectors (Catalog No ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA encoding human TMPRSS2 (NM_005656; OHu13675D) was obtained from Genscript. The cDNA fused to a C-terminal HA tag was subcloned into pQXCIH (Clontech ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Cell Biology 2022Quote: ... IA) and human TOM1L2 (long isoform NP_001076437 gene synthesized by Genscript) were PCR amplified and cloned in FRT vectors with mNeonGreen (NG) ...
-
bioRxiv - Biophysics 2022Quote: ... The gene that encodes human SERINC5 (OHu11910D) was purchased from GenScript.
-
bioRxiv - Molecular Biology 2023Quote: A bacterial codon-optimized human MITF-M+ ORF synthesized by GenScript Biotech was cloned using Gibson assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... human ARL15 (NM_019087.3) in the pcDNA3.1+/C-(K)-DYK vector (GenScript) was used and further employed to introduce the mutations into the construct ...
-
bioRxiv - Immunology 2022Quote: ... ACE2 fused to human IgG1 Fc domain was gene synthesized (Genscript) and cloned into pCEP4 ...
-
bioRxiv - Biophysics 2023Quote: ... human TRPM5 in pcDNA3.1+ (Accession No: NM_014555.3) was purchased from GenScript, and zebrafish TRPM5 in pEG BacMam was kindly provided by Seok-Yong Lee (Duke University).
-
DTX3L and USP28 fine-tune DNA double strand repair through mutual regulation of their protein levelsbioRxiv - Biochemistry 2023Quote: A codon optimised DNA encoding human USP28 was procured from Genscript and cloned between the NdeI/BamHI multiple cloning site (MCS ...
-
bioRxiv - Immunology 2024Quote: ... were codon-optimized for human cell expression (GenScript Codon Optimization Tool). Gene fragments were each cloned into a pαH eukaryotic expression vector with a C-terminal HRV 3C protease cleavage site ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Biochemistry 2022Quote: ... And then Protein A beads (GenScript) were used to separate Fab fragments ...
-
bioRxiv - Immunology 2021Quote: ... and AmMag Protein A beads (Genscript) or loaded on a protein A (Cytiva ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Protein G-Agarose beads (Genscript), Polyetheleneimine reagent (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein G coated MagBeads (Genscript #L00274) were equilibrated with Binding/Wash Buffer (20mM Na2HPO4 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a multi-tag protein standard (Genscript) was serially diluted in 1xTBS with 0.5% Tween-20 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... PAGE-MASTER Protein Standard Plus (GenScript) was used for the identification of target proteins.
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... and for generation of EGFP-C2-Arp3B plasmid, the mRNA transcript variant 1 encoding murine actin-related protein 3B (Actr3b) (Jay et al., 2000) was synthesized (GenScript Biotech) and cloned into pEGFP-C2 vector (Clontech).
-
bioRxiv - Immunology 2024Quote: ... Heat 500 μl of mouse serumat 56℃ and then incubated the heated serum with 1 ml of washed Protein-G resin (GenScript L00209) overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... custom polyclonal antibodies were generated in rabbits against recombinant fragments corresponding to regions that significantly differ between the two AGOs (GenScript, USA).
-
bioRxiv - Immunology 2021Quote: Biotinylated SARS-CoV-2 S1 protein and biotinylated SARS-CoV-2 N protein were purchased from GenScript. The biotinylated proteins were combined with different streptavidin (SA ...
-
bioRxiv - Biochemistry 2023Quote: ... or proteins were transferred to PVDF membranes using an eBlot L1 protein transfer system (GenScript, Piscataway, NJ) and used for immunoblotting.
-
bioRxiv - Microbiology 2023Quote: ... cell-based expression system and RBD proteins were purified using Protein A affinity resin (Genscript Cat#: L00210). Protein purities were assessed by SDS-PAGE ...
-
bioRxiv - Cancer Biology 2023Quote: Input and IP protein samples were separated on a 4-12% Bis-Tris protein gel (GenScript, M41215C) using Tris-MOPS running buffer and then transferred onto a PVDF membrane and blocked overnight in 3% BSA in PBST buffer (PBS + 0.1% Tween 20) ...
-
bioRxiv - Immunology 2019Quote: Human lipo-IFNα1 (152-189) peptide was synthesized by GenScript (Piscataway, N.J.). Lipo refers to conjugation with the lipid moiety ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Cell Biology 2022Quote: ... human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA), full-length human NSF fused to His6 in pET28 was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... Human CSPβ fused to His6 in pET28a was from GenScript (NJ, USA). The rabbit polyclonal anti-CSP antibody (affinity-purified with the immunogen directed towards the amino acids 182-198 of rat CSP) ...
-
bioRxiv - Immunology 2022Quote: Residues 18-615 of human ACE2 (UniProtKB - Q9BYF1) were synthesized by Genscript and cloned into pINFUSE-mIgG2b-Fc2 expression plasmid (InvivoGen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Codon-optimized cDNAs for human SLC1A2 and SLC1A3 were obtained from Genscript and cloned in pTO vector with or without a N-terminal Strep-HA tag.
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Biochemistry 2021Quote: ... variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... the full-length cDNA of human McIdas was obtained by GenScript (OHu00715) and cloned with an N-terminal GFP tag into the EcoRI/XhoI restriction sites of the pENTR1AminusCmR vector ...