Labshake search
Citations for GenScript :
401 - 450 of 549 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... coli strain BL21 (DE3) cells and purified by Ni-NTA chromatography (GenScript).
-
bioRxiv - Biophysics 2023Quote: ... Sf9 cell pellets with XPD expression were purchased from GenScript (NJ, USA). To purify XPD ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell lysates were separated by 4-20% SDS-PAGE (GenScript M00657) and transferred to a nitrocellulose membrane (0.45 µm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then transfected with 3 μg of CXCR3A plasmids (GenScript, OHU18425C) or CXCR3B expression construct (GenScript ...
-
bioRxiv - Biophysics 2024Quote: Stable cell lines of U87MGwt EGFR and U87MGEGFRvIII were produced by Genscript under a research contract ...
-
Mammalian-unique eIF4E2 maintains GSK3β proline kinase activity to resist senescence against hypoxiabioRxiv - Cell Biology 2020Quote: ... HCT116 cells were cotransfected with plasmid pX330 and cas9 Nuclease (GenScript, Z03386-50) containing sgRNAs targeting exon 7 of eIF4E2-201 ...
-
bioRxiv - Immunology 2022Quote: ... The cDNA sequence synthesized and cloned into pcDNA3.4 for mammalian cell expression (GenScript).
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: Gene synthesis for all insect cell codon optimized constructs was provided by Genscript. The original T ...
-
bioRxiv - Cancer Biology 2021Quote: DLD1 RNASEH2B-KO and 5637 RNASEH2B-KO cell lines were generated by GenScript USA ...
-
bioRxiv - Microbiology 2023Quote: Gene synthesis for all insect cell codon-optimized constructs was provided by GenScript. Both AP2 genes were cloned within the co-expression donor vector pFastBac dual which accepts two constructs ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were probed overnight at 4°C for SEOV N protein (custom, Genscript) at dilution 1:400 in 1xPBS and with secondary antibody AlexaFluor 555 goat α mouse (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Cells were pulsed with 1 µg/mL SIINFEKL peptide (Genscript, Piscataway, NJ, USA) for 1 h at 37 °C prior to use as targets for mouse OTI CTLs.
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... Enriched B cells were stained with Flag tagged SARS-CoV-2 spike (Genscript, Z03481) then incubated with APC conjugated anti-Flag and PE conjugated anti-Flag for double staining ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Cell Biology 2022Quote: ... MATα cells were verified by their lack of response to alpha factor (αF, Genscript) and by their ability to mate with MATa cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PAR sensor cell line was generated by cloning the APLF cDNA sequence (Genscript) into the pHR-FUSN-mCh-CRY2WT plasmid (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Biochemistry 2024Quote: HeLa cells were lentiviral transduced with pLentiCRISPRv2 P-Rex1 guide RNA3 - AGGCATTCCTGCATCGCATC (Genscript SC1678). Forty-eight hours after transduction ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then probed for SEOV N (α SEOV nucleocapsid, custom generated with Genscript) or HTNV N (anti-HTNV nucleocapsid 76–118 ...
-
bioRxiv - Microbiology 2024Quote: ... These gRNAs were transiently transfected into cells using GenCrispr NLS-Cas9-NLS Nuclease (GenScript). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: K562 cells expressing luciferase were transfected with a plasmid containing full-length EGFR (#OHu25437D, GenScript) using lipofectamine 2000 according to the manufacturer’s protocol (Invitrogen) ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transfected with pcDNA3.1-spike-V5 with or without pcDNA3.1-GALNTs-FLAG (Genscript) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: cDNA constructs for expression of recombinant Mac-1 in mammalian cells were generated by GenScript. ITGAM cDNA was cloned into the vector pcDNA3.1/HygroB(+) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were arrested in G1 by addition of 10 µg/ml alpha factor peptide (Genscript) for 1.5 hrs ...
-
bioRxiv - Immunology 2022Quote: ... The following peptides were used for T cell stimulation in ICS assays: Trp1 (NTPQFENL, GenScript), Trp2 (SVYDFFVWL ...
-
bioRxiv - Immunology 2021Quote: ... cells were immunostained using a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058), anti-rabbit IgG peroxidase conjugate ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Immunology 2021Quote: ... CD8+ T cell lines were stimulated with cognate peptide pools or 10µM individual peptides (Genscript) and incubated for 5 hours in the presence of GolgiPlug (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... fixed cells were incubated with MonoRabTM iFluor 647 Rabbit Anti-Camelid VHH antibody (GenScript A01994) and Hoechst 33342 diluted in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: A batch of aE11 expressing hybridoma cells were sent to Genscript (GenScript Biotech [Netherlands] B.V.) for commercial Antibody Variable Domain Sequencing following their standard operating procedures ...
-
Srs2 binding to PCNA and its sumoylation contribute to RPA antagonism during the DNA damage responsebioRxiv - Molecular Biology 2024Quote: Cells from log-phase cultures were treated with 5 μg/mL α factor (GenScript RP01002) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles for spike transduction were generated by transfecting 293T cells with pMD2.G (Genscript), psPAX2 (Genscript ...
-
bioRxiv - Bioengineering 2023Quote: ... buffer at pH 9 was functionalized with a thiolated cell-adhesive RGD peptide (GenScript, GCGYGRGDSPG) via a Michael-type addition reaction ...
-
bioRxiv - Genomics 2023Quote: Cell lysates from HMLE shLuc and shM2 were separated by 4-20% SDS-PAGE (Genscript) and transferred to a PVDF membrane (10600023 GE) ...
-
bioRxiv - Bioengineering 2023Quote: ... dLN cells were restimulated in vitro in the presence of either OVA257-264 peptide (Genscript) at a final concentration of 1 mg/mL ...
-
bioRxiv - Microbiology 2024Quote: ... Cleared cell lysates were incubated with 50 μL of anti-FLAG agarose beads (Genscript, L00425) for 2 hours at 4 °C using a tube rotator ...
-
bioRxiv - Biophysics 2024Quote: ... Cell lysate was then loaded onto an SDS-PAGE gel (GenScript Biotech Corporation, Jiangsu, China) and transferred to a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Immunology 2022Quote: RMA-S/HLA-E cells were incubated with serial dilutions of peptides (3-300 μM, Genscript) in OptiMEM (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: For the comparation of OT-I cells activated with different concentrations of OVA257-264 (SIINFEKL, GenScript), OT-I splenocytes were activated with OVA257-264 (1 nM ...
-
bioRxiv - Immunology 2022Quote: ... cell culture media was clarified by centrifugation and the IgG captured using Protein G resin (Genscript). The IgG were eluted from the Protein G resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Neuroscience 2021Quote: ... these cells were cultured in the presence of the OVA257-264 peptide (GenScript RP10611 or Sigma S7951). After 12 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... exponential cells growing in YPDA medium were synchronized with 15 μg/ml α-factor (GenScript Cat. No:RP01002) for 2h at 25 °C ...