Labshake search
Citations for GenScript :
401 - 450 of 1060 citations for Mouse anti Plasmodium falciparum HRP 2 antibody M482 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... with 200 μg of recombinant mouse IFN-γ alone (Genscript), 250 μg anti-CD115 (clone ASF98 ...
-
bioRxiv - Physiology 2019Quote: ... The primary antibody was prepared using a custom affinity-purified rabbit polyclonal antibody (Genscript, Piscataway, NJ) produced against Rhodnius prolixus RhoprCAPA-2 (EGGFISFPRV-NH2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Microbiology 2022Quote: Antibody genes were synthesized by Genscript and recombinantly produced in a human IgG backbone ...
-
bioRxiv - Microbiology 2021Quote: ... Purified antibody was produced by Genscript as human IgG in HD 293F mammalian cells ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Microbiology 2022Quote: ... while the TAP antibody (Genscript, Inc) and the HA monoclonal antibody 2-2.2.14 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... This antibody was generated by GenScript, and is derived from the same peptide sequence used to elicit “3148” from the Nelson’s lab (46) ...
-
bioRxiv - Immunology 2023Quote: ... THETM DYKDDDDK tag antibody (A00188; Genscript) and Direct-BlotTM HRP anti-mCherry antibody (clone 8C5.5 ...
-
bioRxiv - Microbiology 2024Quote: ... The EspE antibody (1:5,000 dilution) was a custom rabbit polyclonal antibody against the CGQQATLVSDKKEDD peptide (Genscript).
-
bioRxiv - Synthetic Biology 2022Quote: ... and 2 mL Protein A slurry (1 mL resin, GenScript) was deposited in the columns ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two replicates for each antibody (LY-CoV016, LY-CoV555, REGN10987, and S309 [Genscript, Gene-to-Antibody service]) assay on different days ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... anti-S2 (SinoBiologicals #40590-D001) and anti-NC (Genscript #HC2003). Human and rhesus IgG antibodies were both detected in these calibration assays using biotinylated affinity-purified goat anti-human IgG γ chain polyclonal antibody (SBA #2048-08) ...
-
bioRxiv - Microbiology 2020Quote: Custom rabbit polyclonal antibodies (GenScript, Nanjing, China) raised against tryptic peptides of Mtb EsxN (AQAASLEAEHQAIVR ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated detection antibody (GenScript, Cat# 5E10G8-Biotin) was added at 1 µg/mL final concentration in blocking buffer and plate was incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (Starr et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Both antibodies were recombinantly produced by Genscript. The rREGN10987 is that used in (25 ...
-
bioRxiv - Cell Biology 2020Quote: ... Coronin peptide antibody was generated by GenScript as peptide-KLH conjugation in New Zealand rabbits (sequence in Table 3) ...
-
bioRxiv - Immunology 2020Quote: ... and the CD3/CD4 bispecific antibody (Genscript) to expand CD8 T-cells ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
CASC3 promotes transcriptome-wide activation of nonsense-mediated decay by the exon junction complexbioRxiv - Molecular Biology 2020Quote: ... anti-EIF4A3 (Genscript), anti-FLAG (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-Flag (GenScript), Anti-c-Myc (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-GLTSCR1 (GenScript), anti-BRD9 (Bethyl ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His6 (Genscript), and anti-σA (gift of David Rudner ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Neuroscience 2019Quote: ... which is 99% similar to the mouse version was synthesized by Genscript and cloned into the pAAV-hSyn-LMO3 plasmid to replace the hSyn promoter ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng/ml mouse recombinant Sonic Hedgehog (SHH)-C25II (Genscript, Z03050-50), and 10 μM CHIR99021 (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmid construct with the mouse Ch25h gene in pcDNA3.1 (Genscript, OMu18523D) was used to define the standard curve ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2020Quote: ... Notch 2 (1:100; LSBio) and Presenillin-1 (1:100; Genscript) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 N and S1 proteins were obtained from Genscript and Sino Biological.
-
Tail Length and E525K Dilated Cardiomyopathy Mutant Alter Human β-Cardiac Myosin Super-Relaxed StatebioRxiv - Molecular Biology 2023Quote: For experiments where 2’-deoxyadenosine-5’-triphosphate (dATP) (GenScript, Piscataway, NJ) was used to limit the myosin SRX state29 ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 2 mL of nickel resin (GenScript) at RT for 20 minutes and washed once with lysis buffer and another three times with wash buffer (20 mM Tris-Cl pH8.8 ...