Labshake search
Citations for GenScript :
401 - 450 of 1258 citations for Mouse WAP kazal immunoglobulin kunitz and NTR domain containing protein 1 WFIKKN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... a single synthetic gene containing the aforementioned individual caspase activity sensors was designed (GenScript, Piscataway, USA). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... we synthesized a 170 bp sequence containing the WT CDC20 promoter sequence (chr1:43,824,464-43,824,633) (GenScript). From this template ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Immunology 2023Quote: ... standard curves were generated using a synthetic plasmid containing a segment of the E-gene (GenScript) and interpolation was performed as described by Feld et al.71 ...
-
bioRxiv - Biochemistry 2023Quote: A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... The optimized sequence was cloned into a pET-28a (+) vector containing a kanamycin resistant gene (Genscript) and transformed into E ...
-
bioRxiv - Immunology 2019Quote: ... and passed through a 2ml custom packed protein G agarose column (GenScript). The pooled sera was recycled three times over the column ...
-
bioRxiv - Immunology 2021Quote: ... protein was incubated overnight at RT with anti-FLAG resin (L00432, Genscript) to remove unreacted XCL1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Extracted proteins were separated in 4-20% precast gradient PAGE gels (Genscript) and transferred to PVDF membranes for immunoblot ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells expressing Hu08TM were stained with biotinylated protein L (GenScript, Piscataway, NJ) and secondary detection was achieved by the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Synthetic Biology 2020Quote: DNA sequences encoding proteins with 6xHis tags were codon-optimized by Genscript and cloned into pET28b+ or pET29b+ vector under the control of a T7 promoter ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Cell Biology 2020Quote: ... Bound protein was eluted using an excess of FLAG peptide (Genscript, China). The eluate was concentrated using Sartorius spin columns with a cutoff of 30kDa (Sartorius) ...
-
bioRxiv - Biochemistry 2021Quote: ... The Broad Multi Color Pre-Stained Protein Standard from GenScript (Piscataway, NJ) was used for calibration ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified protein was used for raising polyclonal antibodies in rabbits (Genscript). Optimal detection of SAP05 in phytoplasma-infected plants occurred at a 1:2,000 dilution of the antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The IgG was purified by affinity chromatography using Protein G-agarose (Genscript) and exchanged into PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... and captured on a 15 mL column Protein A Sepharose resin (Genscript), beads were washed with 50 column volumes of PBS and eluted with glycine buffer pH 3.0 into 1.5 M Tris-HCl pH 8.0 before overnight dialysis into PBS pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins in SDS buffer were electrophoresed using gradient polyacrylamide gels (Genscript, #M00652). CHK-2 bands were excised and stored at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: Protein samples were separated at 150 V in 4% - 20% SurePage (Genscript) polyacrylamide gels using MOPS-SDS running buffer and 1x NuPAGE LDS sample buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were resolved in an ExpressPlus 4-12% gradient gel (GenScript), electroblotted to a nitrocellulose membrane ...
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein G Magnetic Beads were pre-incubated with V5 antibody (A01724, Genscript) for 4 h and crosslinked with 10 volumes of crosslinking buffer containing 20 mM DMP (3 mg DMP/ml of 0.2 M Boric Acid pH 9 ...
-
bioRxiv - Plant Biology 2024Quote: ... then proteins were purified using Ni–Charged Resin (GenScript, Cat. No. L00223). The bands of NopTP and NopT ...
-
bioRxiv - Plant Biology 2024Quote: ... coli followed by protein purification using Glutathione Resin (GenScript, Cat. No. L00206). About 80μg cleaved NFR5 was collected for analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of 100 ng/µL Cas9 protein (GenScript, New Jersey, USA) and 300 ng/µL gRNA for the injection into the eggs (per egg 2 nL was injected ...
-
bioRxiv - Biophysics 2019Quote: ... TRPV2 was eluted with Wash Buffer containing 0.006% DMNG and 3 mg/ml 1D4 peptide (GenScript USA) and subjected to size-exclusion chromatography using a Superose 6 column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Developmental Biology 2022Quote: ... A custom CRISPR gRNA library pool containing 2159 gRNAs was designed and synthesized by GenScript (Piscataway, NJ). The PCR products were amplified and ligated into the pLentiGuid-Puro vector through BsmBI restriction via GenBuilderᵀᴹ Plus assembly ...
-
bioRxiv - Genetics 2019Quote: ... We also designed the piggyBac vector containing tetR-3xFlag-HA and obtained the plasmid synthesized by GenScript. We transfected the plasmids with Super PiggyBac Transposase Expression Vector (System Biosciences ...
-
bioRxiv - Biophysics 2022Quote: ... and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues, purchased form GenScript, Piscataway, NJ) and enNTS1 (containing the full set of 10 methionine residues ...
-
bioRxiv - Microbiology 2023Quote: Plasmids containing partial CVB5 Faulkner (CVB5F) genome (Accession Number: AF114383) in a pUC57 vector were purchased (GenScript) and were cloned by Gibson Assembly55 using Gibson Assembly Mastermix (NEB ...
-
bioRxiv - Genetics 2019Quote: Rabbit polyclonal antibody for full-length mouse ZCWPW1 was made by GenScript. Rabbits were immunized with the full-length ZCWPW1 recombinant protein ...
-
bioRxiv - Biophysics 2019Quote: Human/mouse codon-optimized sequences encoding MerMAIDs were synthesized (GenScript, Piscataway, NJ) and cloned into the p-mCherry-C1 vector using NheI and AgeI restriction sites (FastDigest ...
-
bioRxiv - Neuroscience 2019Quote: ... which is 99% similar to the mouse version was synthesized by Genscript and cloned into the pAAV-hSyn-LMO3 plasmid to replace the hSyn promoter ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng/ml mouse recombinant Sonic Hedgehog (SHH)-C25II (Genscript, Z03050-50), and 10 μM CHIR99021 (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... 4) TCRβ-CD3δ crosslinking: mouse anti-V5 and rabbit anti-FLAG (Genscript); 5 ...
-
bioRxiv - Immunology 2022Quote: ... 7) TCRβ-CD3ε crosslinking: rabbit anti-V5 and mouse anti-HA (Genscript); 8 ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmid construct with the mouse Ch25h gene in pcDNA3.1 (Genscript, OMu18523D) was used to define the standard curve ...
-
LRP1 mediates leptin transport by coupling with the short-form leptin receptor in the choroid plexusbioRxiv - Neuroscience 2023Quote: ... and pcDNA3.1(+)-N-HA-mLepR (mouse LepR isoform A CDS; NM_001122899.2, Genscript) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: The intein-7-140 α-syn fusion protein cDNA was synthesized by GenScript and inserted into a pT7-7 plasmid ...
-
bioRxiv - Plant Biology 2021Quote: ... using a highly efficient wet protein transfer system (eBlot L1; GenScript, Nanjing, China). The membranes were blocked for 2 h at room temperature in TBST solution (2 mM This-HCl ...
-
bioRxiv - Biochemistry 2021Quote: LD membrane protein cDNAs in pcDNA3.1+/C-(k)DYK were purchased from GenScript and their variants with the OPG2 tag ...
-
bioRxiv - Immunology 2022Quote: ... and the supernatants were further purified with protein A magnetic beads (Genscript, L00695).
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was collected pre-cleared with 20 µl Protein A/G MagBeads (GenScript) per 1.5 ml lysate for 30 minutes ...
-
bioRxiv - Cell Biology 2023Quote: Protein samples were separated in a pre-cast SDS-PAGE gel (GenScript, M00657) and blotted to a PVDF membrane (EMD Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins with a His tag was purified with the Ni-NTA resin (Genscript) according to the product manual ...