Labshake search
Citations for GenScript :
401 - 450 of 766 citations for Archaemetzincin 2 AMZ2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Antibodies from each rabbit were purified and quantified individually (Genscript BioTech; Piscataway, NJ).
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... scapularis Relish monoclonal custom antibody used in this study was generated by Genscript. Mice were immunized three times with 0.2 mg of the tick N-Rel immunogen (Rel homology domain ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH was detected using an antibody purchased from Cell Signaling (Cat#97166S) and ORF1 and ORF2 were detected using antibodies generated by GenScript. Finally ...
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Genetics 2024Quote: ... HRP-conjugated mouse monoclonal antibody against FLAG was obtained from GenScript (Cat# A01428).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were run in 2% agarose gel electrophoresis using a 100 bp DNA ladder (GenScript; CAT: M102O).
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... dissolved in sterile H2O at 10mM) and BcNEP2 (Botrytis cinerea Necrosis and Ethylene-inducing protein 2; AIMYSWYMPKDEPSTGIGHRHDWE, Genscript www.genscript.com ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... we designed and purchased an anti-horse-SLN polyclonal antibody from Genscript (pAb GS3379). The immunogen was a 6-residue N-terminal peptide of horse SLN (Q1MEWRRE6C) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... EsxA and SodA were generated for this study (Customer’s Antigen Polyclonal Antibody Package, Genscript). C-terminally his6-tagged SiEsaA41-871 ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...
-
bioRxiv - Microbiology 2020Quote: ... or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript). After washing 50 µL of TMB substrate (Tetramethylbenzidine ...
-
bioRxiv - Immunology 2022Quote: ... The polypeptide antibody against shrimp NLRP3 (aa29-42) was prepared by GenScript (Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... which were coated in anti-HIS antibody [Biotin] (GenScript A00613, mouse IgG1k clone 6G2A9) at 2.5 μg/mL ...
-
bioRxiv - Biophysics 2022Quote: ... Biotin-labeled mouse monoclonal antibody against the Strep-tagII (“NWSHPQFEK”) was purchased from Genscript (GenScript Cat# A01737 ...
-
bioRxiv - Cell Biology 2022Quote: ... Slc37a2 peptide antibodies were produced using the PolyExpressTM service by GenScript (New Jersey, USA).
-
bioRxiv - Plant Biology 2019Quote: ... SlMai1-myc or synSlMai1-myc proteins were detected using anti-Myc antibodies (GenScript; A00704) and chemilumiscent ECL Plus substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... GrgA and mutants were detected using a monoclonal anti-His antibody (Genscript, Cat. A00186) and a mouse anti-GrgA antibody (35).
-
bioRxiv - Biochemistry 2020Quote: A custom-made mouse monoclonal antibody against the isoDGR motif was prepared by GenScript Corporation (Piscataway ...
-
bioRxiv - Cell Biology 2021Quote: ... Western blot analysis was performed using THETM DYKDDDDK Tag Antibody [HRP-conjugated] (A01428, GenScript) and Monoclonal Anti-polyHistidine−Peroxidase (A7058 ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Biochemistry 2022Quote: ... The following phospho-specific antibodies were used: pS384-RPA70 (monoclonal, custom generated by Genscript), pS10-Histone H3 (Cell Signaling ...
-
bioRxiv - Cell Biology 2022Quote: ... GiGrx5 and GiBolA proteins were detected by a rabbit anti-BAP polyclonal antibody (GenScript). Mitosomal GiTom40 and GiIscU were detected with a specific polyclonal antibody raised in rabbits (84) ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with an anti-EsxA1 rabbit polyclonal antibody (0.5 μg/ml; GenScript) in the above LI-COR blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The variable regions of heavy and light chains for each antibody were synthesized (GenScript), cloned into gWiz or pCDNA3.4 vector ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... TotA was used as immunogen to produce rabbit anti-TotA antibody (made by GenScript).
-
bioRxiv - Microbiology 2023Quote: ... anti-VHH monoRab antibody conjugated to horse-radish peroxidase (Genscript, catalogue number A01861-200) was added at a concentration of 0.2 µg/mL (0.1 mL per well ...
-
bioRxiv - Immunology 2023Quote: ... A CM5 chip with covalently immobilized anti-Avi polyclonal antibody (GenScript, Cat #: A00674-40) was used for surface capture of His-Avi tag containing RBDs ...
-
bioRxiv - Immunology 2023Quote: ... Transduced cells were detected by eGFP expression or by an anti-VHH antibody (Genscript) directed against the nanobody constituting the extracellular domain of the CAR and analyzed by flow cytometry.
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated with either anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing the monoclonal antibodies were purified using protein A magnetic beads (Genscript, L00695). The purified samples were determined by SDS-PAGE.
-
bioRxiv - Immunology 2024Quote: ... and incubated with FITC conjugated anti-FLAG mouse monoclonal antibody (GenScript, Cat. No. A01632) at a concentration of 2 µg per million cells for 1 hr at 37 C in the dark ...