Labshake search
Citations for GenScript :
401 - 450 of 838 citations for 7 Chloro 6 fluoro 1 4' fluoro phenyl 1 4 dihydro 4 oxo 3 quinoline carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Two plasmids (pMT-1 and pMT-2) were constructed by Genscript® using vector pUCP22.
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were anti-strep tag (GenScript, A01732, 1/1000), anti-PHF21A (in house ...
-
bioRxiv - Genomics 2024Quote: ... and shRNA oligos for insertion (Table 1) were synthesized by GenScript. Oligos were reconstituted in water at a concentration of 100 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... His-ERK was further purified using 1 mL glutathione resin (GenScript) to remove any residual GST-tagged MKK1.
-
bioRxiv - Microbiology 2023Quote: ... affinity-purified rabbit polyclonal (peptide SSTEPASTGTPSSGC, produced by GenScript, 1:1000), followed by donkey anti-rabbit Alexafluor555 (Invitrogen A31572 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Neuroscience 2019Quote: ... control non-related target knockdown (5′-AGTGGATTCGAG-AGCGTGT-3′) (GenScript). To produce lentiviral particles ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Molecular Biology 2020Quote: ... was directly amplified from a plasmid containing a codon-optimized version of klp-7 (klp-7_co synthetic gene) synthesized from GenScript (Table S5).
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...
-
bioRxiv - Immunology 2020Quote: ... The S1-N-terminal domain (S1-NTD, amino acids 16-318) was custom synthesized by GenScript. Each protein was expressed with an N-terminal His6-Tag to facilitate purification ...
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Antagonist peptide 1 (SCSLFTCQNGIV) and 2 (SCSLFTCQNGGGWF) were chemically synthesized by Genscript. Anti-Mouse-IgG (H&L ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µg/ml rabbit anti-chick MMP13 custom-made primary antibody (GenScript, Piscataway ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Tartan (Rabbit, 1:100, This study, GenScript, based on Full-length peptide). Donkey and Goat secondary antibodies conjugated to AlexaFluor488 ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with 1:200 rabbit anti-S tag (Genscript A00625) overnight and 1:1000 mouse anti GFP (Thermo Fisher A-11120 ...
-
bioRxiv - Microbiology 2019Quote: ... A codon-optimized version of RVB Bang117 NSP1-1 was synthesized (Genscript) and cloned into pLIC8 and pLIC6 using ligation-independent cloning following PCR amplification with appropriate primers and T4 DNA polymerase treatment ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: Polyclonal antibodies against Peptide-1 was raised in rabbit (GenScript, NJ, USA). Crude proteins from root tissues ...
-
bioRxiv - Biochemistry 2021Quote: ... a mouse monoclonal DKY-Tag antibody diluted 1:1,000 (GenScript, Cat# A00187) and a mouse monoclonal anti-β-Actin antibody diluted 1:1,500 (Sigma Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Two commercially available ACE2-Fc proteins obtained from Genscript (Cat.No. Z03484-1) and Acrobiosystems (Cat.No ...
-
bioRxiv - Biochemistry 2022Quote: ... α-actinin-1 and myotilin derived peptides were obtained from Genscript (USA). For immunofluorescence imaging we used goat anti-human VPS35 (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... were coated with S-2P protein 1 μg/mL (Genscript, Piscataway, NJ), RBD protein 1 μg/mL (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µM DrkBiT peptide (VSGWALFKKIS, synthesized by GenScript at >95% purity) was then prepared and added to wells in triplicate on four white 96-well plates (Greiner Bio-One) ...
-
bioRxiv - Physiology 2023Quote: ... VSMCs were treated with either 1 ng/ml human TNFα (GenScript, Z00100) or 2.4 mM inorganic phosphate in the absence or presence of 0.1μM GSK2656157 (Cayman ...
-
bioRxiv - Biochemistry 2023Quote: ... gene blocks containing A5 fused with alternative purification tags (Genscript; Table 1) were inserted via standard cloning techniques and digested with NcoI and NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: The following commercial antibodies were used: FLAG (A00187, GenScript, mouse, 1:1000); HA (11867423001 ...
-
bioRxiv - Neuroscience 2023Quote: The spike peptides (Table 1) were custom ordered and synthesized by Genscript, Netherlands as previously described in Nyström et al 2022 (20) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... DARPins were detected with rabbit anti-FLAG antibody (GenScript, A01868; 1:5,000) and goat anti-rabbit-AP antibody (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using an anti-Histidine-tag primary antibody (Genscript A00186; 1:3000 dilution) and an IR800 conjugated secondary antibody (Li-Cor Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-EBV BALF0/1 rabbit mAb (generated by Genscript for this study), anti-EBV ZEBRA Mouse mAb (BZ1 ...
-
bioRxiv - Microbiology 2024Quote: ... anti-PicA (dilution = 1:1,000; custom polyclonal rabbit antibody generated by GenScript), and anti-RpoB-HRP (loading control ...
-
bioRxiv - Molecular Biology 2023Quote: ... pET-28a-6xHis-TEV-3xFLAG-ATP6V1H(1-351) was purchased commercially (GenScript). pFBDM-ATG7-ATG10-ATG12-StrepII2x-ATG5-ATG16L1 and pFDM-SH-SUMO*-Hrr25 were described previously (Schreiber et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... One membrane was incubated with the anti-transthyretin antibody (1:1,000; Genscript) in 5 % milk overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... the membrane was incubated with an anti-transthyretin antibody (1:1,000; Genscript) overnight in 5% milk in TBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Bioengineering 2020Quote: ... in the presence of varying amounts of argininylglycylaspartic acid (RGD, CGRGDS, 2.0 mM, Genscript, George Town, KY), heparin-binding peptide (HBP ...
-
bioRxiv - Biochemistry 2022Quote: ... A peptide corresponding to the human CRX homeodomain (amino acids 39 to 98) was synthesized by Genscript.
-
bioRxiv - Immunology 2022Quote: RBD-CompA gene based on previously described amino acid sequence [24] was synthesized and cloned by Genscript in the pcDNA3.4+ vector.
-
bioRxiv - Biophysics 2023Quote: ... Some single amino acid mutants were generated by site-directed mutagenesis and others were purchased synthesized (GenScript).