Labshake search
Citations for GenScript :
401 - 450 of 960 citations for 7 Diethylamino 3 5 6 dimethyl 2 benzoxazolyl 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Each 7-mer D-peptide with an N-terminal cysteine was synthesized by GenScript (Piscataway, NJ). Peptides were conjugated with IRDye 800CW maleimide (Li-Cor ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... Wells were washed 3 times in PBS and incubated with 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fluorogenic peptide cleavage assays were performed at 37 ° C with 1 μM coreAFG3L2WB or its variants and 50 uM peptide (Leu-(3-NO2-Tyr)-Phe-Gly-(Lys-Abz)) (GenScript) in a 384-well black plate using SpectraMax M5 plate reader (ex = 320 nm ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2022Quote: ... Mice from WT and CST-KO groups were injected intraperitoneally once daily with CST (2 μg/g body weight; Genscript Biotech Corporation, Piscataway, NJ) for 15 days based on previous experimentation 15 ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Microbiology 2022Quote: ... The pcDNA3-SARS-CoV-2-Spike plasmid contains a codon- optimized ORF for Spike from GenBank NC_045512 that was synthesized by GenScript (a kind gift from David Kelvin) then cloned between the KpnI and BamHI sites of pcDNA3.1(+) ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Biochemistry 2022Quote: Fluorogenic oligonucleotide substrate 5’6-FAM-dArUdAdA-6-TAMRA3’ was purchased from GenScript. Unless state otherwise ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 5 peptides matching inoculum sequences for both the WT and SS14-DCKO strains (Table 3, labelled with a superscripted “1”) were produced by Genscript (Piscataway, NJ). Upon reception ...
-
bioRxiv - Genetics 2023Quote: ... every 1 μg RNA solution was ligated with 3 μl 25-μM poly(A)-ssRNA adaptor (pAGCUAAAAAAAAAAAAp, synthesized by GenScript Biotech Co.) at 16 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies were dissolved in 5% BSA (Biofroxx, 4240GR005) and the dilutions were: Streptavidin-HRP (1:2000, GenScript, M00091), RL2 (1:1000 ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
bioRxiv - Neuroscience 2023Quote: ... # E7) in 5% non-fat milk TBST and FOLR1 antibody in 5% non-fat milk TBST (GenScript). Anti-GFP antibody or normal rabbit IgG were used as controls in FOLR1-CD2AP co-IP experiments.
-
bioRxiv - Cell Biology 2021Quote: ... which was synthesized to contain 7 modified TetO elements flanked by two minimal CMV promoter sequences based on pTet-T2 sequences (GenScript) (49) ...
-
bioRxiv - Biochemistry 2020Quote: ... coli codon-optimized version of VC1 coding for an N-terminal His-tag and lacking the predicted cTP-coding region (Supplementary File 7) was synthesized (GenScript) and cloned into expression vector pET22b(+ ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were generated by synthesis of Flex-mCherry and Flex-eGFP and inserted into humanized M plasmids described in [7] using EZcloning from Genscript. The SARS-CoV-2 N protein was tagged at the N-terminus ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Developmental Biology 2020Quote: ... ID U3154EL200-3)27 or Tbx4-LME containing putative Tcf/Lef sites mutated (GenScript, ID U3154EL200-6) were synthesized and cloned into pGL4.23 (luc2/minP ...
-
bioRxiv - Molecular Biology 2023Quote: The 6-FAM-labeled and non-labeled RNA oligonucleotides were synthesized chemically by GenScript. The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Genetics 2023Quote: ... Identified homozygous PC-9_ EGFRdel19-ARTi clones were further engineered by cutting endogenous EGFR with a CRISPR all-in-one vector pX458_Exon20_gRNA TAGTCCAGGAGGCAGCCGAA (GenScript) using X-tremeGENE 9 DNA transfection reagent (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Biophysics 2020Quote: Mouse 5-HT3AR gene (purchased from GenScript) and mutant genes were inserted into pTLN plasmid ...
-
bioRxiv - Immunology 2019Quote: ... The PIFS model employed by our group involves the tail vein injection of 100μL of a 1mg/mL solution of VP2121-130 peptide (FHAGSLLVFM) in PBS at either 7 or 14 days after the original TMEV infection (GenScript, Nanjing) [38-43] ...
-
bioRxiv - Molecular Biology 2020Quote: ... was directly amplified from a plasmid containing a codon-optimized version of klp-7 (klp-7_co synthetic gene) synthesized from GenScript (Table S5).
-
bioRxiv - Bioengineering 2023Quote: ... The PNIPAM conjugation reaction was altered to modify either 0.5 or 1 arm of the PEG-vinyl sulfone while the unreacted 7 arms were further reacted with excess P peptide (EYPPYPPPPYPSGC, 1563 g/mol; GenScript Corp.). Conjugation reactions were confirmed via 1H nuclear magnetic resonance ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Biophysics 2020Quote: ... Synthetic DNAs were purchased as GeneBlocks from IDT (5’ leader constructs) or as Gene Parts from GenScript (5’UTR constructs). All synthetic DNAs had a 5’-terminal XmaI consensus sequence and 3’-terminal HindIII consensus sequence ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Immunology 2019Quote: ... 5 µg/ml TSKB20 (ANYKFTLV) peptide (Genscript Inc.) or 50 ng/mL PMA plus 500 ng/ml ionomycin (Sigma ...
-
bioRxiv - Bioengineering 2023Quote: ... soluble RGD (5 mM RGD peptide, GCGYGRGDSPG, Genscript) was added to media in the 3% experimental group and outgrowth after 3 days was compared to PBS controls ...
-
bioRxiv - Immunology 2022Quote: ... binding of SARS-CoV2 and control IgG antibodies (at 1 µg/ml) to 15-mer S2 overlapping 5-amino acid peptides (n=52, GenScript Biotech, 500 ng/well) was tested using the same procedure as previously described (Wardemann ...