Labshake search
Citations for GenScript :
401 - 450 of 1023 citations for 5 Methoxy 1 Triisopropylsilyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... Control (#2) and p53 gRNA (#4) vectors targeting human TP53 (GenScript, pLentiCRISPR v2, Piscataway, NJ, USA) were used to homozygously delete the TP53 gene in H1975 cells as per manufacturer instructions.
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with washing buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with an overlapping peptide pool derived from SARS-CoV-2 Spike protein (Genscript). Following 2 hours of culture ...
-
bioRxiv - Biochemistry 2024Quote: ... The cleared lysate was incubated with 2 ml of MonoRab anti-DYKDDDDK Affinity Resin (L0076; GenScript) for 30 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... and 35 kPa (7% 20 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript). Flat bottom hydrogels were fabricated by first plasma treating µ-slides 8 well (Ibidi USA ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... 1 (Genscript Biotech). Additionally ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... the PVDF membrane was blocked by 5% skim milk in TBST and incubated with HRP-conjugated streptavidin (GenScript, M00091) for the enhanced chemiluminescence detection ...
-
bioRxiv - Microbiology 2021Quote: ... The resin was washed with 60 mL of buffer A supplemented with 2 mM CaCl2 and the bound protein was eluted from the column with 10 mL of buffer A supplemented with 5 mM EDTA and 0.2 mg/mL FLAG peptide (Genscript).
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 5 μM of recombinant (PR)20 peptides (with a C-terminal HA epitope tag, Genscript) for 10 days ...
-
bioRxiv - Cell Biology 2024Quote: ... α-factor was added to the cells to a final concentration of 5 ng/ml α-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2022Quote: ... KIR-CD3ζ JNL cells were also incubated with parental 721.221 cells as negative control and with anti-Flag-tag (5 µg/ml) (clone 5A8E5, GenScript) and goat anti-mouse (10 µg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... Specific anti-CoV immunoreactivity was detected using SARS-CoV-2 nucleocapsid antibody (GenScript Biotech, Piscataway, NJ, USA) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... A rabbit anti-SARS-CoV-2 neutralizing antibody (4G6) was purchased from Genscript (Cat. No. A02053-100). Rabbit monoclonal antibodies against 6-His-tags (12698S ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Biophysics 2024Quote: The codon-optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Biophysics 2024Quote: ... named EKAR-1 (GenScript). To create entry vectors ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... The crRNA (0.1nmole) was first annealed with an equimolar amount of transactivating crRNA (tracrRNA) in 5 µl in the annealing buffer (GenScript) by heating at 95°C for 5 min followed by rapid chilling ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Molecular Biology 2022Quote: ... The galanin-GAL1R-Gi complex was formed in membranes by the addition of 5 μM galanin peptide (synthesized by GenScript) and 25 mU/mL apyrase ...