Labshake search
Citations for GenScript :
401 - 450 of 1131 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Purified SARS-CoV-2 S1 protein (GenScript) in carbonate buffer ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Biochemistry 2024Quote: WT-CCNE1-3xFLAG (GenScript, Lot:U8948FB050-2/PD40693), N112C-CCNE1-3xFLAG (GenScript ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μL of 800 nM LwaCas13a (Genscript), 1 μL of a 1.6 μM target-specific Cas13 crRNA ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of reporter (1000 nM, GenScript Biotech Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... and KCGPQGIWGQCK (MMP-2 degradable peptide; GenScript) were used as crosslinkers in a 70:30 molar ratio respectively and were dissolved in 15 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 2 µL of 500 nM LwaCas13a (GenScript, #Z03486 ...
-
bioRxiv - Immunology 2021Quote: ... linked by a 6 aa linker and including a C-terminal HIS-tag were prepared by Genscript® (Piscataway ...
-
bioRxiv - Biochemistry 2023Quote: ... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... and 5 mM RGD peptide (Ac-RGDSPGERCG-NH2, Genscript) in PBS at a rates of 0.5 - 5 µL/min ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was mixed with 5× sample buffer (GenScript), heated to 100°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Hydrogel precursor solution was prepared by incorporating thiolated RGD peptide (GCGYGRGDSPG, 1 mM, Genscript) to promote integrin-mediated cell adhesion and lithium acylphosphinate (LAP ...
-
O-GlcNAcylation reduces phase separation and aggregation of the EWS N-terminal low complexity regionbioRxiv - Biochemistry 2021Quote: ... residues 1-264 (N-terminal LCR; LCRN) was synthesized by GenScript (Piscataway, NJ, USA) with codon optimization for expression in Escherichia coli ...
-
bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Immunology 2020Quote: HLA-A*0201-restricted MART-1 peptide ELAGIGILTV) was synthesized by GenScript (Nanjing, China). Peptide was stored at 10 mg/ml in 100% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Immunology 2020Quote: MART-1 originated peptide ELAGIGILTV (HLA-A*0201) was synthesized by GenScript (Nanjing, China) with a purity of ≥ 99.0% ...
-
bioRxiv - Molecular Biology 2022Quote: ... VHL 3KR-14-3-3ζ (1-230) 19KR K49E mutation were synthesized by GenScript Biotech ...
-
bioRxiv - Microbiology 2022Quote: ... The following antibodies were used: rabbit anti-GST (GenScript, A00097, 1:2000 for WB), rabbit anti-Flag (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequences were split into 1–1.5 kilobase fragments and ordered as GenParts from GenScript. Primers were ordered from QuintaraBio to amplify from the ends of each GenPart ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell adhesion was enabled through the incorporation of 1 mM RGD peptide (GCGTGRGDSPG, Genscript) in all hydrogel groups.
-
bioRxiv - Cancer Biology 2022Quote: FITC-CCNL1321-332 peptides (numbering according to Uniprot Q9UK58-1) were purchased from GenScript and FITC-cyclin E377-384 peptides (numbering according to Uniprot P24864-3 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then stimulated with 1 μM of test peptides (custom peptide synthesis, GenScript) or control reagents as indicated in each relevant figure legend and costimulatory antibodies anti-CD28 (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... Serum samples were diluted (1:10) and preincubated with 100 ng/ml RBDmFc (Genscript) in blocking buffer for 1 hour at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated for 1 h with monoclonal anti-nucleocapsid virus mouse antibody (Genscript) diluted 1:1000 in blocking buffer (PBS 1X containing 1% BSA (Sigma Aldrich ...
-
bioRxiv - Pathology 2024Quote: The following primary antibodies were used for western blot: TSP2 Antibody (1:250, GenScript), β-Catenin Antibody (1:500 ...
-
bioRxiv - Biochemistry 2024Quote: ... and eluted by W1 buffer supplemented with 250 μg ml-1 Flag peptide (Genscript). The eluent was concentrated and further purified by size-exclusion chromatography (Superose-6 Increase 10/300 column ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-MBP tag Mouse Monoclonal antibody was used at 1:1000 dilution (GenScript, A00190), GST tag Mouse Monoclonal antibody was used at 1:1000 dilution (STARTER ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 4-12% gradient precast SurePAGE gels (GenScript), and subsequently transferred to nitrocellulose membranes (Amersham Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... proteins were separated on 4–12% SurePAGE gradient gel (M00725, GenScript), transferred to Immobilon-P PVDF membrane (IPVH00010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were separated by 4-20% SurePAGE™ Gel (GenScript) for 1 h at 140V and then transferred to PVDF membranes for 2 h at 75V ...
-
bioRxiv - Biophysics 2022Quote: ... then synthesized and cloned into the pET26b(+) vector in frame with an C-terminal 6 × His tag (GenScript). BL21 DE3 cells were transformed with the plasmid and grown at 37°C in TB media supplemented with 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 pseudoviruses were purchased from GenScript, and neutralization activity was measured using the HEK-293T-ACE2 cell line with the same procedures as mentioned above.
-
bioRxiv - Biophysics 2020Quote: The CoV-2 3CLpro sequence was synthetized (GenScript) for optimized expression in E ...
-
bioRxiv - Immunology 2020Quote: ... using IgE-SARS-CoV-2 spike plasmid (Genscript) and pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified FMO-2 protein was purchased from GenScript. Purified FMO5 protein ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 fusion peptide was synthesized (GenScript).