Labshake search
Citations for GenScript :
351 - 400 of 531 citations for Recombinant Human VNN2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Cell Biology 2020Quote: The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2019Quote: ... The human ELK4 gene coding sequence was ligated into pIRES2 vector (GenScript, Piscataway, NJ, USA) to construct the ELK4 overexpression plasmid ...
-
bioRxiv - Biochemistry 2019Quote: ... Synthetic human non-biotinylated HEG1 7-mer peptide (residues 1375–1381) was purchased from GenScript. His6-EGFP-KRIT1(WT ...
-
bioRxiv - Immunology 2021Quote: ... a 3.5kb fragment of the human CLEC7A promoter region (chr12:10129421-10132905) was synthesized (GenScript) and cloned into the secreted Nano-Glo luciferase vector pNL1.3 (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Biophysics 2022Quote: The mRBD (331-532) codon optimised for human cell expression was synthesized by GenScript (USA) (35) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human HSPE1-GFP was cloned into pcDNA3.1 from the HSPE1 (NM_002157.2) ORF Clone (OHu17870D, Genscript). The HSPE1-GFP constructs were transfected into cells using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli optimized coding sequence for human FMRP (isoform 1) was designed and synthesized by Genscript, and then subcloned into pET His6 MBP TEV LIC cloning vector (1M) ...
-
bioRxiv - Molecular Biology 2022Quote: We purchased the full-length human LRRK1 gene from Genscript (residues 1-2015, uniprot Q38SD2), codon optimized for Homo sapiens ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Human C-type natriuretic peptide (CNP) and rat atrial natriuretic peptide (ANP) were from GenScript Corp ...
-
bioRxiv - Biochemistry 2023Quote: A pcDNA 3.1 plasmid containing the full length human cytoglobin gene was purchased from GenScript. The empty vector control and specific point mutations of this plasmid were also generated by GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... Human and hamster ACE2 (Q9BYF1.2 and GQ262794.1, respectively) were synthesized and cloned into pcDNA3.1+ (GenScript). All DNA constructs were verified by Sanger sequencing (ACGT) ...
-
bioRxiv - Biochemistry 2020Quote: ... Human codon-optimized HSPH1 fused C-terminally to a Myc-tag was expressed from pcDNA3.1 (Genscript). cDNA encoding wild-type human ubiquitin containing an N-terminal HA-tag was expressed from pRK5-HA (Addgene) ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding human codon-optimized spike genes with the desired mutations were purchased (GenScript, Piscataway, NJ). Supernatants containing pseudoviruses were collected 48 h post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: Synaptopodin A was synthesized by Genscript using the coding sequence of human synaptopodin (NCBI Reference Sequence: NP_009217.3) and was subcloned by Genscript into HINDIII and Xho1 sites of the blasticidin-selectable mammalian expression vector pcDNA6 myc-HisA (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... and non-human private were determined by the virus surrogate neutralization kit (cat # L00847, Genscript, Singapore). The percent of neutralizing virus in sera were determinded according to the manufacturer’s protocol
-
bioRxiv - Biophysics 2020Quote: The Rh-PDE (full) gene (NCBI Gene ID: 16078606) was synthesized after human codon optimization (GenScript), as described previously13 ...
-
bioRxiv - Biochemistry 2021Quote: Codon optimized constructs of the truncated versions of human Syx were designed and obtained from GenScript. Fusion constructs were generated as described previously(48 ...
-
bioRxiv - Cell Biology 2022Quote: Three subunits of the human mTORC1 complex (mTOR, Raptor, mLST8) were codon-optimized and synthesized (GenScript). The mTOR gene was cloned into a pCAG vector without a tag ...
-
bioRxiv - Immunology 2022Quote: ... The cells were cultured for 24 hours prior to being treated with: Human IL11 (UniProtKB:P20809, GenScript), human TGFβ1 (PHP143B ...
-
bioRxiv - Immunology 2022Quote: Antibody heavy and light chain genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (pCMV3-CH ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct consisting of human APP770 cDNA in the pcDNA3.1 backbone was custom made (GenScript, Piscataway) and then sequenced ...