Labshake search
Citations for GenScript :
351 - 400 of 1104 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... The mCherry WT- dynamin-2 was constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 surrogate virus neutralization test (GenScript) was used to detect neutralizing antibodies targeting the viral spike (S ...
-
bioRxiv - Immunology 2023Quote: ... 2 µg/mL biotin conjugated Env peptides (GenScript, customized) were added to plates and incubated for 1 hour at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The custom polyclonal p-Smurf2Thr249 antibody was generated (#J1683BA260-5) (GenScript). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... All AtLEA4-5 Scrambled ORFs were synthesized as gene fragments (Genscript).
-
bioRxiv - Evolutionary Biology 2022Quote: Protein G (5 μg/ml, 50 μl/well; Genscript, China, Z02007) was diluted to 5 μg/ml with PBS (0.01 M ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), or 5 μl heat-killed bacteria in PBS ...
-
bioRxiv - Plant Biology 2024Quote: The quenched peptides (Qps) from flagellin were commercially synthesized with a DABCYL N-terminal modification and a Glu-EDANS C-terminal modification (GenScript, Piscataway, New Jersey, United States) at a purity of 95% (Supplemental Table S3) ...
-
bioRxiv - Immunology 2022Quote: ... DNA encoding SARS-CoV-2 HexaPro Spike was synthesized (Genscript) and transiently transfected in FreeStyle 293F cells (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... and 0.6 μg/mL SARS-CoV-2 S-ECD (GenScript). After washes with PBST (SMART-Lifesciences) ...
-
bioRxiv - Physiology 2022Quote: ... The WT dynamin-2 mCherry plasmid were constructed by GenScript Corporation (Nanjing ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Physiology 2024Quote: ... The protein samples were mixed with 5× sample buffer (MB01015; GenScript, US) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Biochemistry 2024Quote: ... were coated with 20 µl 5 µg/mL Protein A (Genscript, Z02201) in 100 mM sodium bicarbonate pH 9.6 at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... polyclonal anti-Bma-LAD-2 peptide antibodies were generated by Genscript. Rabbits were immunized with Bma-LAD-2 peptide sequences conjugated to keyhole limpet hemocyanin (KLH) ...
-
bioRxiv - Immunology 2022Quote: The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding SARS-CoV-2 and other coronavirus S-2P (Genscript) were transiently transfected in FreeStyle 293-F cells (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Microbiology 2021Quote: ... Codon-optimized spike of SARS-CoV-2 was purchased from GenScript and subcloned to pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: ... SARS CoV-2 Nucleocapsid human chimeric mAb (GenScript, Cat # A02039-100), or in-house antibodies to ORF3a and ORF8 served as positive controls ...
-
bioRxiv - Microbiology 2022Quote: ... An anti-SARS-2 nucleocapsid protein rabbit antiserum (generated by GenScript) was used at a 1:1000 dilution to detect specific anti–SARS-2 immunoreactivity using the Discovery ULTRA automated staining instrument (Roche Tissue Diagnostics ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-2 Spike Glycoprotein-crud (RP30020, GenScript Biotecn Corp). A ten amino acid overlapping peptide mixture pool was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 spike gene (Wuhan) was synthesized by Genscript for Dr ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with DTT (2 mM) and TEV protease (cat. # Z03030, GenScript), and dialyzed against buffer C (50 mM K2HPO4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and SARS-CoV-2 nsp gene sequences were codon optimized (Genscript). Sequences for Gammacoronavirus galli IBV/M41/Y28 proteins originate from the GenBank sequence QWC71293.1 ...
-
bioRxiv - Immunology 2021Quote: ... cells were stimulated ex vivo with 5 μg/mL OVA257-264 peptide (GenScript) for 4 hours in the presence of Golgi stop (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... Cultures were blocked by addition of 5 μg/ml of α factor (GenScript) every 90 min in YPAD until <10% cells were budded ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of a synthetic antigen peptide (Genscript, 0.2 mg/ml in PBS), eBioscience Cell Stimulation Cocktail (Fisher Scientific 00-4975-93 ...
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... CENP-T was fluorescently labeled with a GGGGK-TMR (5-Carboxytetramethylrhodamine) peptide (GenScript) using the Calcium-independent Sortase 7M (Hirakawa et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the samples were boiled in 5 х Loading Buffer (GenScript, Piscataway, NJ, USA) and subjected to SDS-PAGE or immunoblotting with indicated antibody.
-
bioRxiv - Cell Biology 2020Quote: Recombinant SARS-CoV-2-RBD (T80302) was obtained from Genscript (NanJing, China). Antagonist peptide 1 (SCSLFTCQNGIV ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Immunology 2022Quote: ... 2) TCRα-CD3δ crosslinking: rabbit anti-cMyc and mouse anti-FLAG (Genscript); 3 ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2-RBD-his protein was purchased from GenScript (GenScript, Nanjing), and GPC5-his protein was purchased from R&D (Minneapolis ...
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV-2 spike protein (ECD, His & Flag Tag) (GenScript Z03481). Proteins were biotinylated using EZ-Link™ Sulfo-NHS-Biotin ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/ml MHC-I binding SIINFEKL peptide (ovalbumin 257-264, GenScript), or 2 µg/ml ISQAVHAAHAEINEAGR MHC-II binding peptide (ovalbumin 323-339 ...
-
bioRxiv - Neuroscience 2023Quote: The riboprobes were synthetized from 2 clones that were purchased from Genscript or obtained by BBSRC ChickEST Database (Boardman et al. ...
-
bioRxiv - Immunology 2023Quote: The SARS-CoV-2 Surrogate Virus Neutralization Test Kit (GenScript, L00847-A) was used according to the manufacturer’s instructions as follows ...
-
bioRxiv - Immunology 2024Quote: ... The SARS-CoV-2 Mac1 macrodomain was cloned into pcDNA3.1 by Genscript with both an N-terminal 3XFLAG tag and a C-terminal HiBiT tag as listed in Supplementary Table 5 ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sangon Biotech) and RNA (5’-GCGUCGCAGGCCUUUUUAUU-3’; 0.39 mM, final concentration; GenScript Biotech Corp.) in 50 μL annealing buffer (5 mM Tris-HCl ...
-
bioRxiv - Pathology 2022Quote: ... Jagged-1 peptide (1 uM, Genscript), Y-27632 (10 uM ...