Labshake search
Citations for GenScript :
351 - 400 of 551 citations for 5 acetyl 2 methylfuran 3 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... Human codon-optimized cDNA encoding SARS-CoV-2 spike glycoproteins of various strains were synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... Specific anti-CoV immunoreactivity was detected using SARS-CoV-2 nucleocapsid antibody (GenScript Biotech, Piscataway, NJ, USA) at a 1:1000 dilution ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Microbiology 2021Quote: ... N501Y.V1 (Variant 1) mutant Spike proteins of SARS-CoV-2 were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Microbiology 2023Quote: ... A rabbit anti-SARS-CoV-2 neutralizing antibody (4G6) was purchased from Genscript (Cat. No. A02053-100). Rabbit monoclonal antibodies against 6-His-tags (12698S ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cDNA encoded the SARS-CoV-2 PLpro with mammalian codon optimization was also ordered from GenScript and cloned into the pcDNA 3.1 with an C-terminal FLAG tag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The solubilized supernatant fraction was incubated with 2 mL anti-FLAG affinity resin (GenScript Biotech, Piscataway, NJ) and stirred at 4°C for 2 hrs ...
-
bioRxiv - Immunology 2023Quote: Lentiviral vectors for expression of SARS-CoV-2 spike (Delta variant B.1.617.2, NCBI accession # OX014251.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Microbiology 2022Quote: ... Omicron BA 1.1 spike (from Dr. Raul Cachau, NIAID) or CoV-2 Spike RBD (His-Tag, Genscript) was diluted in phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2023Quote: ... NCBI accession # OX014251.1) and Sars-CoV-2 nucleocapsid (NCBI accession # OP359729.1) were designed and synthesized from Genscript together with the two packaging plasmids (pMD2.G and psPAX2) ...
-
bioRxiv - Biophysics 2024Quote: The codon-optimized gene encoding the isoform 2 of full-length human HGSNAT was synthesized by GenScript. The synthesized gene was then cloned into the pEG BacMam expression vector (Addgene plasmid # 160683 ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were incubated for 5 minutes at 95 °C and run on a 4-20% gradient SDS-PAGE gel (Genscript).
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... The crRNA (0.1nmole) was first annealed with an equimolar amount of transactivating crRNA (tracrRNA) in 5 µl in the annealing buffer (GenScript) by heating at 95°C for 5 min followed by rapid chilling ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Molecular Biology 2022Quote: ... The galanin-GAL1R-Gi complex was formed in membranes by the addition of 5 μM galanin peptide (synthesized by GenScript) and 25 mU/mL apyrase ...
-
bioRxiv - Microbiology 2022Quote: ... A sequence in which each CTD serine 5 residue was replaced by an alanine was ordered as synthetic gene (GenScript) and subcloned in place of the wild-type CTD sequence into the G2-CTD construct (G2-CTD-S5A) ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant fraction was then incubated with 5 μg of the indicated antibodies and protein A-agarose beads (GenScript L00210) at 4°C on a nutator for 5 h ...
-
bioRxiv - Immunology 2021Quote: ... The plate were then washed with PBS once and then 200,000 splenocytes were added to each well and stimulated for 24 Hrs at 37°C in 5% CO2 with pool of 12-mer peptides (GenScript) at a concentration of 5.0 μg/well spanning the entire SARS-CoV-2 S protein along with Negative control (RPMI 1640 supplemented with 10% FBS and 1X antibiotic and positive control (Concanavalin A ...
-
bioRxiv - Microbiology 2024Quote: ... The CRISPR array extended with a BsrG1 restriction site at the 5’ end was synthesized in pUC19 (GenScript Biotech, Netherlands).
-
bioRxiv - Biochemistry 2024Quote: ... The reaction was stopped at different time points by adding Laemmli sample buffer and incubating the samples 5 min at 95 °C before loading them on Bis-Tris-SDS 4-20% polyacrylamide gels (SurePAGE, GenScript).
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 100 µl of MaSC medium (DMEM/F12 containing 5% FBS, 10 ng/ml EGF [Novoprotein, C029], 20 ng/ml FGF2 [GenScript, Z03116] ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The RBD-ACE2 assay was performed using SARS-CoV-2 sVNT ready to use kit sold by Genscript Inc ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a portion was taken for replating (2×10^4 cells per replicate) with human (GenScript Z03034-50) or mouse (GenScript Z02767-10 ...
-
bioRxiv - Biochemistry 2021Quote: Full length SARS-CoV-2 nsp3 was codon optimized and cloned into a pcDNA-(+)-C-DYK vector (Genscript). Truncations were performed using primers listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... SARS-CoV-2 nsp7 gene (nucleotide 11846-12091, GenBank: MN908947.3) was synthesized de novo by GenScript (Nanjing, China) and cloned into the pMal-c5X vector using the same way as nsp8 ...
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... a commercial competitive ELISA SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) was used (Genscript, New Jersey, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Neutralizing antibodies were routinely detected based on the SARS-CoV-2 Surrogate Virus Neutralization Test (sVNT) kit (GenScript). This ELISA-based kit detects antibodies that hinder the interaction between the receptor binding domain (RBD ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Biophysics 2022Quote: The codon-optimized gene encoding the nsp7-10 region of SARS-CoV-2 polyprotein was synthesized commercially (GenScript) and cloned between the NdeI and XhoI sites of pET15b vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The clarified cell lysate was incubated with 2 ml pre-equilibrated Ni2+ charged magnetic resin purchased from GenScript. Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... dissolved in sterile H2O at 10mM) and BcNEP2 (Botrytis cinerea Necrosis and Ethylene-inducing protein 2; AIMYSWYMPKDEPSTGIGHRHDWE, Genscript www.genscript.com ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% penicillin-streptomycin) supplemented with 50 mM 2-mercaptoethanol and 1 μg/ml OVA257-264 (SIINFEKL) peptide (GenScript) at at 37 °C and 5% CO2 for 3 days ...
-
bioRxiv - Immunology 2023Quote: ... 50 μl of phycoerythrin (PE)– conjugated human angiotensin-converting enzyme 2 (ACE2) (hACE2; 1 μg per milliliter; GenScript) was added to the well and incubated for 30 minutes at 37°C with agitation ...
-
bioRxiv - Microbiology 2021Quote: ... Lysed cells were denatured with SDS at 95°C for 5 min and separated on an 10% SDS PAGE (SurePAGE Bis-Tris, 10×8, GenScript, M00666) at 200V for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... After clearance by ultracentrifugation (45 min, 120,000 g) the lysates were incubated with either FLAG-antibody- coated beads (Genscript, L004332-5) or Strep-Tactin®XT 4Flow high capacity resin (IBA life sciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant SARS-CoV-1 spike protein was obtained from SinoBiological and SARS-CoV-2 spike was obtained from Genscript and Acro Biosystems.
-
bioRxiv - Microbiology 2021Quote: ... Initial peptide scanning was performed by the binding of a series of SARS-CoV-2 S2 synthetic peptides (GenScript) to immobilized CV3-25 IgG (∼5800 RU ...
-
bioRxiv - Plant Biology 2021Quote: ... The filtered supernatant was mixed with 2 mL slurry of previously washed and equilibrated Glutathione Sepharose 4B beads (GenScript). After incubation ...
-
bioRxiv - Biochemistry 2022Quote: ... Uniprot identifier C3LP26) and Vibrio cholerae serotype O1 (strain M66-2) FeoB (Uniprot identifier C3LP27) were synthesized by GenScript. Materials used for buffer preparation ...
-
bioRxiv - Immunology 2022Quote: ... A codon-optimized version of the full-length spike gene of the Wuhan-1 SARS-CoV-2 strain (MN908947.3; GenScript) was cloned into the Monogram proprietary env expression vector ...