Labshake search
Citations for GenScript :
351 - 400 of 648 citations for 2 4 Methoxyethoxy 3 methyl 2 pyridinyl methylthio benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Sample absorbances were compared to the neutralization curve of a commercially available anti-SARS-CoV-2 RCB monoclonal antibody (GenScript, Catalog # A02051) of known concentration to extrapolate antibody titers ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Immunology 2020Quote: ... derived from a peptide scan [15-mers with 11 amino acid overlap] through Spike glycoprotein of SARS-CoV-2) (JPT, Cat: PM-WCPV-5 or GenScript, Cat: RP30020). Phorbol Myristate Acetate (PMA ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Immunology 2022Quote: ... and 1-3 x 105 cells were stimulated for 24-48 hours with 11 SARS-CoV-2 Spike peptide pools (17- or 18-mers with 11 amino acid overlap) (Genscript, Piscataway, NJ) at a concentration of 1μg/mL per peptide ...
-
bioRxiv - Biochemistry 2022Quote: ... or by adding 200 ng/well of monovalent or bivalent cAbCMY-2 (254) recognized by 1/2000 diluted rabbit anti-HCAbs antibody conjugated to HRP (Genscript, United States). TMB was used as substrate while reaction was stopped by 1 M H3PO4 ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Immunology 2022Quote: 15-mer peptides overlapping by 10 amino acids spanning the entire protein sequence of SARS-CoV-2 Spike were synthesized (GenScript; see Table S1). To stimulate whole blood or PBMC ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... A protease solution (9.5 ml lysis buffer with 2 mM TCEP and 500 µl His-tagged TEV protease (10KU, Genscript or in-house purified)) was then added to release DDX4N1 CtoA into the solution during over-night incubation at room temperature with gentle mixing ...
-
bioRxiv - Biochemistry 2024Quote: ... and the supernatant was loaded onto a gravity Ni-NTA column (2-5 ml Ni-charged resin FF from GenScript, Cat# L00666-25). The Ni-NTA column was washed and then the His-tag fused protein was eluted using step-gradient of imidazole (50 ...
-
bioRxiv - Cell Biology 2023Quote: Western blots were performed using ExpressPlus PAGE Gel 4-12% or 4-20% (GenScript). Proteins were transferred to PVDF membranes (MERCK-Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... Gradient gels (4-12% GenScript) were used in all experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4%-20% (GenScript, M00657) precast gradient gels and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-12% gel (GenScript, #M00654) and separated by MOPS buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Microbiology 2022Quote: ... Mice from WT and CST-KO groups were injected intraperitoneally once daily with CST (2 μg/g body weight; Genscript Biotech Corporation, Piscataway, NJ) for 15 days based on previous experimentation 15 ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA for SARS-CoV-2 Spike protein ectodomain residues 1 to 1220 (S-Ectodomain-GFP) was chemically synthesized with optimal insect cell codons (Genscript USA Inc, NJ, USA) and cloned into pVL1393 (Expression Systems ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Neuroscience 2023Quote: ... in the middle of exon 2 was conjugated to KLH to improve antigenicity of the peptide sequence followed by polyclonal antibody production in rabbits (Genscript, Inc. Piscataway, NJ, USA). Anti-Bdwf antibody was affinity purified against the antigenic peptide and specificity was confirmed by immunohistochemistry analyses.
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2022Quote: ... The pcDNA3-SARS-CoV-2-Spike plasmid contains a codon- optimized ORF for Spike from GenBank NC_045512 that was synthesized by GenScript (a kind gift from David Kelvin) then cloned between the KpnI and BamHI sites of pcDNA3.1(+) ...
-
bioRxiv - Pathology 2021Quote: ... Samples were mixed by vortexing and tested using the GenScript cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript USA, Inc. Piscataway, NJ, USA) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
TRANSITION OF PODOSOMES INTO ZIPPER-LIKE STRUCTURES IN MACROPHAGE-DERIVED MULTINUCLEATED GIANT CELLSbioRxiv - Cell Biology 2020Quote: ... IL-4 was from Genscript (Piscataway, NJ).
-
bioRxiv - Microbiology 2023Quote: ... 4%-20% gradient SurePAGE gel (GenScript, #M00657); Tris-MOPS-SDS running buffer (GenScript ...
-
bioRxiv - Immunology 2023Quote: ... or 4-20% gradient gels (GenScript #M00656). Proteins on gels were transferred to nitrocellulose membranes (Bio-Rad #1620115 ...
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... and eluted with 3 x Flag peptide (GenScript, RP21087), concentrated using an Amicon™ Ultra-4 centrifugal filter (Sigma-Aldrich ...