Labshake search
Citations for GenScript :
351 - 400 of 846 citations for 1 Ethylbenz cd indol 2 1H ylidene malononitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant from centrifugation at 12000 rpm for 45 min was applied to 2 mL of Anti-DYKDDDDK G1 Affinity Resin (GenScript) which was washed five times by 5 mL of wash buffer I (25 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Expression constructs encoding ERBB4 JM-a CYT-2 point mutants listed in Supplementary Table S1 were created by cloning mutant inserts from pDONR221-vectors (Genscript) into pBABE-puro-gateway retroviral mammalian expression vector (a gift from Matthew Meyerson ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Biochemistry 2024Quote: The TRI2-2 and influenza virus minibinders were cloned into pET29b between the NdeI and XhoI restriction sites by Genscript. The TRI2-2 minibinder was cloned with a C-terminal polyhistidine tag and the influenza minibinder was cloned with an N-terminal polyhistidine tag17 ...
-
bioRxiv - Cell Biology 2022Quote: ... GRGDSPC peptide (1% w/v) (Genscript) was added to the solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Biophysics 2020Quote: ... MEC-10 and DEGT-1 (GenScript) in the pGEM-HE oocyte expression vector (Liman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... CSP-1 (GenScript, New Jersey, USA), as previously described (36) ...
-
bioRxiv - Cell Biology 2022Quote: ... or GST (1:500, Genscript A00865), followed by 1:3000 HRP-conjugated Goat anti-rabbit or Goat anti-mouse secondary antibodies (Bio Rad) ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μM TPI peptide (Genscript).
-
bioRxiv - Biophysics 2022Quote: ... and 1 μM TPI peptide (Genscript) for surface expression of TPI:HLA-DR1 ligand for the E8 TCR.35
-
bioRxiv - Developmental Biology 2022Quote: ... DUXBL (1:500, custom antibody, GenScript), HDAC1 (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG (1:1,000 (A00187, GenScript, RRID:AB_1720813)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse anti-V5 (1:10,000; Genscript), Anti-V5 tag antibody [SV5-P-K](1:5,000 ...
-
bioRxiv - Molecular Biology 2024Quote: Purified Aβ42 (Genscript, Cat# RP20527-1), was solubilized in 1% NH3 at 12.5mg/ml then diluted to 1mg/ml in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... additionally CRGDS peptide (1 mM, GenScript) was added for cell adhesion ...
-
bioRxiv - Biochemistry 2024Quote: Protein A resin (1 mL, GenScript) was prepared by washing with 25 mL TBS in a gravity purification column ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep (Genscript, A01732, 1:1000), goat anti-rat IgG (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Antigens included recombinant SARS-CoV−2 RBD protein obtained from the Saphire laboratory at LJI or recombinant nucleocapsid protein (GenScript Z03488). The next day ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysate was heated at 95°C for 5 min and centrifuged at 10000 rpm/s for 2 min to remove the insoluble material prior to SDS-PAGE in a 4-20% gradient ExpressPlus™ PAGE Gels (Genscript) at constant 120 V for 1 h ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length open reading frames of the S genes of SARS-COV-2 variants were cloned into pcDNA3.1(+) or pVRC8400 by GenScript (Piscataway, NJ). The spikes of variants used in this study were listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2020Quote: ... Target proteins were obtained with purity >85% and endotoxin level <2 EU/mg (LAL Endotoxin Assay Kit, GenScript, Cat. No. L00350). In addition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Plasmid pcDNA3-PLpro-flipGFP-T2A-mCherry was constructed from pcDNA3-TEV-flipGFP-T2A-mCherry.15 SARS-CoV-2 PLpro expression plasmid pcDNA3.1-SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization ...
-
bioRxiv - Immunology 2022Quote: ... were coated overnight with 250 ng/well of purified recombinant Coronavirus proteins and 500 ng/well of a SARS-CoV-2 fusion sequence-containing peptide (KRSFIEDLLFNKVTLADAGFIK, GenScript Biotech). After washings with 0.05% Tween 20-PBS (washing buffer) ...
-
bioRxiv - Biophysics 2020Quote: SARS CoV-2 main protease (Mpro or 3CL) gene from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET29a(+ ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: A 96-well plate was coated overnight at 4ºC with 100 µL of a recombinant human ACE-2 fused to a Fc fragment (GenScript Laboratories, USA) at 1 µg/mL in carbonate buffer (pH 9.6) ...
-
bioRxiv - Microbiology 2021Quote: ... of SARS-CoV-2 spike protein to Angiotensin Converting Enzyme (ACE2) was assessed via the Surrogate Virus Neutralization Test (GenScript# L00847) using the included kit protocol modified per the following ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length S genes of SARS-COV-2 variants (using D614G as the base plasmid) were cloned into pCDNA3.1(+) (GenScript, Piscataway, NJ). The HIV gag/pol (pCMVΔR8.2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA fragments with wild type or mutation MTB DNA sequences were synthesized and cloned into pUC19 plasmid by GenScript (Figure 2). Concentrations of these plasmids are quantified by Bio-Rad ddPCR platform following the user guide ...
-
bioRxiv - Molecular Biology 2023Quote: ... or its mutants with codon optimization in Escherichia coli species were synthesized and cloned into the pGEX-6P-2 vector (GenScript, Nanjing). The resulting plasmid was transformed into BL21(DE3 ...
-
bioRxiv - Immunology 2022Quote: ... We designed an S gene of SARS-CoV-2 with some modifications described below and synthesized it from GenScript (Piscataway, NJ). The S protein precursor has two well-defined cleavage sites ...
-
bioRxiv - Immunology 2023Quote: ... DNA template containing loxP sites flanking exon 2 of the Sparcl1 “loxP-Sparcl1_Ex2-loxP” was synthesized by Genscript (Genscript Biotech Corp.) and purified ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 million cells/well were added into a 6-well plate and cultured with 2 mL RPMI-1640 medium/well (10 ng/mL IL-4, and 20 ng/mL mGM-CSF, GenScript, China) to obtain BMDCs at 37°C with 5% CO2 ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6) or 2 µL 10X Cas13a reaction buffer (GenScript, #Z03486), 0.5 µL of Murine RNAse inhibitor (New England Biolabs - NEB ...
-
bioRxiv - Biophysics 2022Quote: ... Protein was eluted by incubation with 3 BVs elution buffer (wash buffer supplemented with either 3C protease (1:10 w:w 3C:ABCA7) or 0.5 mg ml-1 1D4 peptide (GenScript)) for 2-18 hours.
-
bioRxiv - Cell Biology 2020Quote: ... 10% glycerol) with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript). S100 supernatant was added directly to 600 μL of basic lysis buffer with protease inhibitors and NEM containing 30 μL 1:1 anti FLAG Affinity Gel (Genscript) ...
-
bioRxiv - Biochemistry 2024Quote: ... Clarified lysate from 1 L of culture was incubated with 1 mL of equilibrated Ni-resin (Genscript) and washed with 30 mL wash buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... the MERS-S gene in the antigenomic plasmid pVSV*ΔG(MERS-S) was replaced by a modified SARS-CoV-2 spike gene (Genscript, Piscattaway, USA) taking advantage of the flanking MluI and BstEII endonuclease restriction sites ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Biophysics 2022Quote: ... the coding sequence for the E protein from SARS-CoV-2 was initially codon optimized for Xenopus laevis and synthesized (GenScript, Piscataway, NJ). The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...