Labshake search
Citations for GenScript :
301 - 350 of 597 citations for Toll Like Receptor 3 TLR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: Rabbit polyclonal antibody for full-length mouse ZCWPW1 was made by GenScript. Rabbits were immunized with the full-length ZCWPW1 recombinant protein ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µg/ml rabbit anti-chick MMP13 custom-made primary antibody (GenScript, Piscataway ...
-
Molecular structure and conformation of stereocilia tip-links elucidated by cryo-electron tomographybioRxiv - Neuroscience 2021Quote: Rabbit polyclonal and monoclonal antibodies were generated using standard techniques by Genscript using the soluble PCDH15 EC1-EL extracellular region as the antigen ...
-
bioRxiv - Genomics 2020Quote: ... An antibody to CENH3 was custom-produced by GenScript (Piscataway, NJ, USA) against a peptide designed based on the C ...
-
bioRxiv - Biochemistry 2021Quote: ... Primary antibodies (anti-FLAG M2; Sigma and chimeric ACE2-Fc (Genscript; Z03484) were diluted in PBS-BSA to 1 μg mL−1 and added to each imaging dish ...
-
bioRxiv - Bioengineering 2021Quote: Monoclonal antibodies against GAA and GILT-tag sequence were generated by Genscript. Mouse plasma samples were screened for the presence of GAA protein using JessTM ProteinSimple and following manufacturer’s protocol (ProteinSimple ...
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... the cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (Genscript, L00847), was used as directed to detect antibodies that bind competitively to the receptor binding domain (RBD ...
-
bioRxiv - Biochemistry 2022Quote: The commercially available SARS-CoV-2 Neutralization Antibody Detection Kit (cPass, GenScript) was used to identify the presence of RBD neutralizing antibodies in the serum samples from mice immunized with r3CL-pro ...
-
bioRxiv - Immunology 2021Quote: A monoclonal anti-SARS-CoV-2 RBD capture antibody (GenScript, Cat# 5B7D7) was coated on Nunc Maxisorp ELISA plates (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... An anti-SARS-CoV-2 Spike monoclonal neutralizing antibody (GenScript, Cat# 6D11F2) was used as a positive control ...
-
A gut-secreted peptide controls arousability through modulation of dopaminergic neurons in the brainbioRxiv - Neuroscience 2020Quote: Rabbit anti-CCHa1 antibodies were raised against the peptide QIDADNENYSGYELT21 by Genscript and affinity purified by the company.
-
bioRxiv - Microbiology 2022Quote: ... The polyclonal antibody against CrPV-1A in rabbits was generated by Genscript. USA.
-
bioRxiv - Immunology 2022Quote: ... A SARS-CoV-2 neutralizing monoclonal antibody (mAb; GenScript, Piscataway, NJ; #A02057), was used as a positive control at a known starting concentration of 3.2 ng/µL followed by serial 1:2 dilutions similarly to each sample and negative control ...
-
bioRxiv - Microbiology 2019Quote: ... discoideum crude extract with an anti-FLAG rabbit polyclonal antibody (GenScript, USA). For ectopic expression assays ...
-
bioRxiv - Plant Biology 2019Quote: Polyclonal antibodies against Peptide-1 was raised in rabbit (GenScript, NJ, USA). Crude proteins from root tissues ...
-
bioRxiv - Biochemistry 2021Quote: ... a mouse monoclonal DKY-Tag antibody diluted 1:1,000 (GenScript, Cat# A00187) and a mouse monoclonal anti-β-Actin antibody diluted 1:1,500 (Sigma Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Erg11 anti-peptide rabbit polyclonal antibody was produced by GenScript (Piscataway, NJ). The peptide sequence was AKIYWEKRHPEQKY ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified protein was used for raising polyclonal antibodies in rabbits (Genscript). Optimal detection of SAP05 in phytoplasma-infected plants occurred at a 1:2,000 dilution of the antibody ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Cell Biology 2020Quote: A custom rabbit anti-TbKH polyclonal antibody (pAb) was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Immunology 2022Quote: ... Specific anti-SCV2 immunoreactivity was detected using a SCV2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a custom made anti-P2 gpV polyclonal antibody generated by GenScript. The secondary antibodies were both from Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... The primary antibody (rabbit anti-ScV-L-A peptide serum by GenScript) was diluted at 2:25000 in 2% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... Antibodies against the SecY peptide MAKQPGLDFQSAKGGLGELKRRC were raised in rabbits by GenScript Biotech (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: The following commercial antibodies were used: FLAG (A00187, GenScript, mouse, 1:1000); HA (11867423001 ...
-
bioRxiv - Microbiology 2023Quote: Custom polyclonal antibodies specific for AmpC and OprD were generated by GenScript. The epitopes for each are listed in Supplemental file 2 ...
-
bioRxiv - Immunology 2023Quote: ... Specific anti-SCV2 immunoreactivity was detected using a SCV2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Genomics 2022Quote: ... All ChIP-nexus experiments were performed using antibodies custom generated by Genscript: Zelda (aa 1117-1327) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... DARPins were detected with rabbit anti-FLAG antibody (GenScript, A01868; 1:5,000) and goat anti-rabbit-AP antibody (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.
-
bioRxiv - Genetics 2023Quote: ... scapularis Kenny custom antibody used in this study was generated by Genscript. Rabbits were immunized three times with 0.2 mg of tick Kenny immunogen (amino acids 223-356) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein G Magnetic Beads were pre-incubated with V5 antibody (A01724, Genscript) for 4 h and crosslinked with 10 volumes of crosslinking buffer containing 20 mM DMP (3 mg DMP/ml of 0.2 M Boric Acid pH 9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using an anti-Histidine-tag primary antibody (Genscript A00186; 1:3000 dilution) and an IR800 conjugated secondary antibody (Li-Cor Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... anti-PicA (dilution = 1:1,000; custom polyclonal rabbit antibody generated by GenScript), and anti-RpoB-HRP (loading control ...
-
bioRxiv - Biochemistry 2023Quote: ... the membranes were incubated with the relevant primary antibody anti-FnCpf1 (GenScript), anti-LbCpf1 (Millipore) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
bioRxiv - Molecular Biology 2024Quote: ... One membrane was incubated with the anti-transthyretin antibody (1:1,000; Genscript) in 5 % milk overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... the membrane was incubated with an anti-transthyretin antibody (1:1,000; Genscript) overnight in 5% milk in TBS-T ...
-
bioRxiv - Molecular Biology 2024Quote: Polyclonal rabbit antibodies against phopsho-TRF1 and TRF2 were generated by Genscript. Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a rabbit polyclonal antibody specific for calmodulin-binding peptide (A00635-40, GenScript), a Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2019Quote: ... Rat polyclonal antibodies against full-length recombinant GST-tagged PfAlba3 were from GenScript Corporation ...
-
bioRxiv - Cell Biology 2021Quote: ... and a mouse monoclonal antibody to detect GAPDH (clone 3B1E9, GenScript A01622–40) were used at a dilution of 1:1,000 in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...