Labshake search
Citations for GenScript :
301 - 350 of 973 citations for Tick Borne Encephalitis Virus Envelope Protein Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... cholerae biovar El Tor strain N16961 (NCBI NC_002506.1) fused to a histidine-tag coding strip placed C-terminal to parE2 was synthesized by Genscript (https://www.genscript.com/). This gene was subsequently cloned into the NcoI-NheI sites of a pET28a plasmid and verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... plasmid (Addgene plasmid #48138)62 containing a guide RNA (5’-ACTGAGCTTGGATGCTTCTG-3’) and a donor plasmid containing 700 bp homology arms and a RPAC1 tag synthesised by GenScript into pUC57-Mini plasmid ...
-
bioRxiv - Biochemistry 2022Quote: ... The hexahistidine tag and Sso7dmut were cleaved from HIV-1 IN by addition of his-tagged sortase and GGGC peptide (GenScript). The reaction was exposed to nickel resin to remove sortase and any residual uncleaved IN ...
-
bioRxiv - Biochemistry 2022Quote: cDNA encoding His6-TEV-pro-conA sequence was synthesized and sub-cloned into pET28a(+) in framed with the N-terminal His-tag (Genscript), followed by transformation into Rosetta PLysS competent cells (Novagen) ...
-
bioRxiv - Biophysics 2022Quote: ... construct cloned in a pGEX-6P-1 vector with an N terminal GST-tag followed by a precision protease site was obtained from GenScript.
-
bioRxiv - Microbiology 2023Quote: ... The plasmid encoding Wag31 with an N-terminal 6xHis tag followed by a TEV protease cleavage site (pET-His-TEV-Wag31) was synthesized by Genscript. The Wag31 N-terminal DivIVA domain (Wag311-61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or vector containing full-length METTL7A or METTL7B with a C-terminus FLAG tag (all vectors from Genscript, Piscataway, NJ) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The chimera VnE-PRM-Prof with an N-terminal twinned-Strep-Tag (ST2) and PreScission-cleavage-site (ST2-(PreScission-cleavage-site)-VnE-PRM-Prof) was cloned by Genscript. The VnE-PRM-Prof chimera was designed to ...
-
bioRxiv - Biochemistry 2023Quote: ... wild-type APE1 was expressed in the absence of any tags from a pet28a codon optimized clone purchased from GenScript. The plasmid was transformed into One Shot BL21(DE3)plysS E ...
-
bioRxiv - Biochemistry 2023Quote: ... vector encoding WT DosS CA (amino acids 454 – 578 of full-length DosS) sequence with an N-terminal 6xHis tag and a TEV protease site was purchased from GenScript. DosS CA mutants were prepared from the WT plasmid via site-directed mutagenesis with end-to-end primers similar to methods described in previous papers.22 The forward and reverse primers (5’ to 3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Molecular Biology 2023Quote: ... NM_003755) with an N-terminal His6 tag was made by inserting DNA between NdeI and XhoI sites of pET15b (GenScript). pET15b-His6-eIF3g was used by GenScript to generate the deletion and substitution mutants.
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: Genes coding for SARS-CoV-2 Spike (S) ectodomains (Hu-1 and BA.1) with Hisx8 and Strep tags were synthesized by Genscript and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Bioengineering 2023Quote: ... and Cellulose synthase 5 (CesA5) gene from moss (Physcomitrella patens) carrying a C-terminal dodeca-HIS-tag [23] was custom synthesized from GenScript and cloned into yeast expression vector pPICZA ...
-
bioRxiv - Biophysics 2023Quote: The plasmids for the expression of codon optimized versions of G4Ps and variants with N-terminal FLAG-His tags in the pET28a backbone were synthesized by GenScript.
-
bioRxiv - Microbiology 2023Quote: ... A recodonized version of full-length PfPK2 with at AvrII and StuI sites upstream of a loxP sequence in frame with GFP tag was custom synthesized as a G-block (Genscript). The resulting plasmid DNA construct (pSLI-PfPK2-loxP ...
-
bioRxiv - Immunology 2023Quote: Full length Erdr1 (Erdr1-177) and Erdr1 deficiency C-terminal 32 amino acid (Erdr1-145) with C-terminal HA tags was synthesized (GenScript) and cloned into pcDNA3.1 plasmid using In-Fusion cloning (Clontech) ...
-
bioRxiv - Biochemistry 2023Quote: The open reading sequences encoding TcdB1-GTD to TcdB8-GTD were synthesized with a C-terminal His6 tag and cloned into pET28a(+) by Genscript. Sequence length and strain information is shown in Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2023Quote: Wildtype and mutant PRD-0038 S constructs consisting of residues 1-1235 and containing a 21 residue C-terminal deletion (del21) followed by a 3x FLAG tag were synthesized by GenScript and placed into an HDM plasmid ...
-
bioRxiv - Biochemistry 2023Quote: The recombinant PLpro wild type and mutants’ genes with an N-terminal Hisx6 tag was introduced into the pET-28b (+) bacterial expression vector by GenScript, Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... and eluted from the column by incubation with either reduced glutathione (to retain the GST tag) or with 10 units Prescission Protease (Genscript) to obtain protein without a tag ...
-
bioRxiv - Biochemistry 2024Quote: ... Equivalent aliquots (15 µL) of each fraction were analysed by SDS-PAGE and immunoblotting using anti-His tag antibody (GenScript) overnight at 4°C as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 bp upstream and downstream of the coxM C-terminus were fused to a twin-Strep II tag (5’GGCGGTTCGGGCTGGTCCCACCCCCAGTTCGAAAAGGGTGGGGGCTCCGGTGGCGGGTCGGGTGGGTCC GCCTGGTCGCACCCGCAGTTCGAGAAG 3’) in a 1111 bp fragment synthesised by Genscript. Two ∼500bp fragments upstream and downstream of the coxG gene were fused to create a deletion construct of 1011 bp and synthesised by Genscript ...
-
bioRxiv - Biochemistry 2024Quote: ... fused to consecutive C-terminal HA (hemagglutinin)- and FLAG-tags and cloned into pCDNA-3.1 plasmid for expression in HEK293 cells by the CMV (cytomegalovirus) promoter (GenScript Biotech). Mutant variants were generated by site directed mutagenesis (GenScript Biotech).
-
bioRxiv - Biophysics 2024Quote: ... or C154Y mutants optimized for expression in yeast were cloned in a pPIC9K vector upstream of a sequence coding for a PreScission protease cleavage site (LEVLFQGP) followed by a linker of 11 amino acids and a 10His tag (GenScript). The plasmids were introduced in Pichia pastoris strain SMD1163 (his4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... coli protein production (Genscript) and used as templates for subsequent cloning ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Cell Biology 2020Quote: ... The human BMI1 sequence (pUC57 vector, GenScript, Leiden, NL) was inserted upstream of the hTERT sequence by enzymatic digestion (XbaI and MluI ...
-
bioRxiv - Microbiology 2019Quote: ... The human TRIM34 cDNA was purchased from Genscript (NM_001003827.1). Human TRIM34 was cloned into pHIV/dTomato using NotI and XmaI sites with an HA tag encoded at the N-terminus ...
-
bioRxiv - Cell Biology 2020Quote: ... TM27 and human IRE1α-TM were synthesized by Genscript. Genes corresponding to the transmembrane peptides with following amino acid sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... Human anti-SP IgG standards (chimera, GenScript, Piscataway, NJ) or human ACE-2 Fc (chimera ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lohse and a ORF human PTH1R (Genscript, cat.no. OHu15045D) was transfected into 293 cells ...
-
bioRxiv - Immunology 2023Quote: ... 50 µL of phycoerythrin (PE)-conjugated human ACE2 (Genscript) was added to each well and incubated for an additional 15 mins at 37°C with agitation ...
-
bioRxiv - Genetics 2023Quote: Genes were human codon-optimized and synthesized by Genscript, and plasmids were generated using a combination of restriction digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The human XIST oligo pool was ordered from GenScript and amplified as previously described to generate ssDNA biotinylated oligos (Engreitz et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Biochemistry 2019Quote: ... NPC2 bound to LBPA isomers was detected by incubating the Snoopers with rabbit polyclonal anti-c-myc-tag antibody (RRID: AB_914457, GenScript, Piscataway, NJ) at a concentration of 0.5μg/ml in TBS + 3% BSA for one hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... a GlySer-linker and the C-tag flanked by PmeI sites was amplified by PCR from a synthetic fragment provided by GenScript (USA), codon-optimized for expression in a low protease background C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNAs encoding mCer-mCit sensor or CRONOS were synthesized and subcloned into pET28a vector containing His6 tag (Genscript, NJ, USA).
-
bioRxiv - Biochemistry 2021Quote: Mammalian expression plasmid pcDNA3.1+/C-(K)-DYK carrying the ORF sequence of WT CYP21A2 (NM_000500.7) with a C-terminal DYK (FLAG) tag was purchased from GenScript (New Jersey, USA). We used this plasmid as a template to create the variants through site-directed mutagenesis ...
-
bioRxiv - Biochemistry 2022Quote: The coding sequence of MtDPP was cloned into plasmid pET28a(+)in frame with an N-terminal 6×His tag (GenScript™). BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coding sequence was synthesised and cloned into a pET28a plasmid with N-terminal His6-tev purification tag (supplied by Genscript Ltd).
-
bioRxiv - Molecular Biology 2023Quote: ... AAP13442.1) with N-terminal His6 tags were made by inserting DNA between NcoI and BamHI sites of pET15b (GenScript, Piscataway, NJ). pET15b-His6-Nsp1(SARS CoV2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs coding for NSP8 and NSP7 proteins were codon-optimised and custom-synthesised with an N-terminal 6X-His tag in the pET28a vector (Figure S1, GenScript, USA). The NSP12 ...
-
bioRxiv - Immunology 2023Quote: DNA encoding for residues 24-167 of the extracellular portion of human PD-1 (UniProt Q15116) with a C-terminus histidine tag or corresponding PD-1 N58Q mutant were cloned into pcDNA3.4 by GenScript (Piscataway, NJ). Expi293 cells were transiently transfected with plasmid DNA mixed with PEI (Polysciences ...
-
bioRxiv - Biochemistry 2022Quote: Codon-optimized gene corresponding to 5 to 897 amino acids of KFDV NS5 with an N-terminal Hexa-histidine tag was synthesized (Genscript USA) and sub-cloned into pET-28a (+ ...
-
bioRxiv - Plant Biology 2022Quote: Proteins were loaded onto 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and 4%-20% Precast Protein Plus Gel (Yeasen ...