Labshake search
Citations for GenScript :
301 - 350 of 858 citations for ST2 Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: The cPass™ kit (GenScript) was used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... ToxinSensorTM Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the labeled nanoparticle were below 50 EU/kg per dose.
-
bioRxiv - Biophysics 2021Quote: ... coli optimized codons for the C0-C2 portion of human cMyBP-C with N-terminal 6x His tag and TEV protease cleavage site were obtained from GenScript (Piscataway, NJ). For TR-FRET binding assays ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA polynucleotides encoding the transmembrane domains showing homology to previously known ACRs optimized for human codon usage were synthesized (GenScript, Piscataway, NJ) and cloned into the mammalian expression vector pcDNA3.1 (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 50 nM human HER2:AF647 (Acro Biosystems) and 30 nM anti-VHH probe (MonoRab anti-Camelid VHH [iFluor 488], GenScript cat #A01862). The SARS-CoV-2 VHH strains were resuspended in saponin based stain buffer (1x PBS ...
-
bioRxiv - Immunology 2022Quote: Synthetic peptides containing the N-loop or the C-terminal sequence of human chemokines were designed and obtained (> 75% purity) from GenScript (Hong Kong). All peptides are biotinylated (biotin-Ahx ...
-
bioRxiv - Immunology 2022Quote: ... total splenocytes were seeded at 0.5×106 cells per well in a 24-well plate and stimulated with 0.1 μM OVA257-264 (Genscript RP10611) peptide and 20 ng/ml recombinant murine interleukin-2 (IL-2 ...
-
bioRxiv - Immunology 2023Quote: ... 5×105 cells per well (6 well plate) were stimulated with 100 ng/mL of IFN-γ (Z02916, Genscript) for 0 h ...
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Cell Biology 2021Quote: ... All SHIP164 (UHRF1BP1L) ORFs used in this study utilized a human codon optimized sequence designed and purchased from Genscript (sequence available upon request). The following constructs were kind gifts ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 1 μg of POR-WT and mutant membrane proteins were separated on an SDS-PAGE gel and blotted on to polyvinyl difluoride (PVDF) membranes to probe with a rabbit polyclonal antibody against wild-type human POR from Genscript (Genscript, NJ, USA) as described previously [43] ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Genetics 2021Quote: ... rat anti-RAD-51 (1:500, (20)), guinea pig anti-SUN-1 S24pi (1:700, (72)), chicken anti-GFP (1:500, (A01694, Genscript)) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti α-Tubulin (Genscript, 1:50-1:100); Anti α-Tubulin (proteintech ...
-
bioRxiv - Immunology 2021Quote: ... One million of freshly isolated splenocytes were seeded into the precoated plates and stimulated with S1 and S2 peptides pools (GenScript) with a final concentration of 1 μg/ml of each peptide diluted in RPMI-1640 supplemented with 10% FBS and incubated for 48 hours at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2022Quote: ... according to the manufacturer’s instructions and plated in 24 well tissue culture plates at 3×106/well in in the presence of OT-I peptide (GenScript) and the following cytokines ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Immunology 2022Quote: Twenty 15-mer peptides (Figure 1A) used in human and mouse T-cell stimulation experiments were chemically synthesized by Genscript (TFA removal, >85% purity). The peptides were dissolved in DMSO at 20 mg/mL (∼12 mM) ...
-
bioRxiv - Bioengineering 2019Quote: ... Absolute concentrations of Rituximab were calculated by comparison with a calibration curve generated from a dilution series of human IgG (A01006, Genscript, New Jersey, NJ, USA). Regeneration of biosensor tips between measurements was performed in 10 mM glycine pH 1.7 ...
-
bioRxiv - Microbiology 2022Quote: ... Immunizations were done on eight-to twelve-week-old H2L2 mice interperitoneally with 50-100 μg of a recombinant SARS-CoV2 Spike RBD319-591-Fc fusion protein generated from sequence from the original Wuhan seafood market pneumonia virus isolate (GenBank Accession# MN908947) and cloned in-frame into pcDNA vectors containing human IgG1 and mouse IgG2a Fc tags (GenScript USA Inc., Piscataway, NJ). Each mouse received a prime followed by 2 boosts ...
-
bioRxiv - Developmental Biology 2023Quote: ... Wild type or a mutant version of the human PDX1 enhancer with 6 CisBP predicted RFX binding motifs mutated (Weirach et al 2014) were commercially synthesized by Genscript (Genscript USA, Piscataway, NJ) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...
-
bioRxiv - Immunology 2023Quote: ... Raw values were normalized to a synthetic standard on each plate (VHH72-Fc by NRC for spike/RBD or an anti-N IgG from Genscript, #A02039). The relative ratios were further converted to BAU/mL using the WHO International Standard 20/136 as a calibrant (33 ...
-
bioRxiv - Genomics 2023Quote: ... with CloneEZ PCR Cloning Kit (GenScript #L00339). The pLenti-GIII-EF1α-CBX3-Flag-HA ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... anti-FLAG (Genscript, A00187: IB, 1:1500; IF, 1:300); anti-GAPDH (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dkk-1 (GenScript) was added to BM at final concentration of 100 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... FAT-1 (Genscript), and FAT-2 (Genscript ...
-
bioRxiv - Bioengineering 2020Quote: ... for detection of anti-L and anti-D antibodies plates were coated with either L-MMP peptide or D-MMP peptide resepcitvely (GenScript; sequence above) Serum samples were tested at a 1:500 dilution followed by incubation with alkaline phosphatase-labeled goat anti-mouse IgG1 or IgG2a ...
-
bioRxiv - Microbiology 2022Quote: The ToxinSensor Chromogenic LAL Endotoxin Assay kit (GenScript) was used to determine endotoxin units/mL of culture ...
-
bioRxiv - Neuroscience 2024Quote: ... a toxin Eraser endotoxin removal kit (#L00338, Genscript) with a high efficiency endotoxin removal resin was employed ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... In white clear bottom 96-well plates 10 μL IL-34 antibody (mouse monoclonal IgG2A (v1.1 manufactured by Genscript, Ma et al., 2012), rat monoclonal IgG2A (MAB5195 ...
-
bioRxiv - Neuroscience 2021Quote: ... plko.1-CMV.Puro-tGFP-shFoxg1 or plko.1-CMV.Puro-tGFP-shLuciferase (Genscript) plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:100 (A00487, Genscript). All secondary antibodies were purchased from Invitrogen and used at 1:700 and were Alexa Fluor-488 Donkey anti-rabbit (A21206) ...
-
bioRxiv - Immunology 2022Quote: ... β-Actin (GenScript, 1:15,000), T-bet (clone 4B10 Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... β-actin (GenScript, 1:15,000), goat anti-mouse (Jackson Immunoresearch ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per well were added to a U-bottom 96-well plate and were stimulated with 5 μg/ml of pools of overlapping SARS-CoV-2 S protein peptides (GenScript USA Inc, Piscataway, NJ). The stimulation was performed by incubation for 6 h at 37°C and 5% CO2 in the presence of Protein Transport Inhibitor Cocktail (brefeldin A ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... 1-932 and EAV nsp9 1-693 was synthesized with codon optimization (Genscript) and cloned into pFastBac with an N-terminal MG addition and C-terminal TEV protease site and two Strep tags ...
-
bioRxiv - Microbiology 2022Quote: ... α-CrPV-VP2 (1:1000, Genscript), α-CrPV-3C (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... S1 (GenScript, Cat # Z03485-1) and RBD (aa 319-591 ...
-
bioRxiv - Cell Biology 2020Quote: ... FLAG (A00187, GenScript (1:1,000)) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:7,500 (GenScript, A01827-200) and ECL2 detection steps ...
-
bioRxiv - Microbiology 2023Quote: ... anti-His (1:4,000) (GenScript), anti-GFP (1:10,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Strep (Genscript A01732, 1: 5,000), c-myc (Invitrogen 13-2500 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 mM RGD peptide (GenScript) was added to the precursor solution ...
-
bioRxiv - Bioengineering 2020Quote: ... and measured by ToxinSensor Chromogenic LAL Endotoxin Assay Kit (Genscript). The purified Nbs were further sterilized by passing a 0.2 μm filter (Millex ...