Labshake search
Citations for GenScript :
301 - 350 of 482 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... DEPQRETLKAIHYALN) and scrambled peptide (Scr; QEALKYNRAETPLDIH) were designed as described previously (4) and synthesized using solid phase Fmoc chemistry (Genscript, New Jersey, USA). The peptide ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were incubated overnight at 4°C with the following primary antibodies: rabbit polyclonal anti-AQP4 (1:4000, GenScript Biotech, Piscataway, NJ, USA), rabbit polyclonal anti-AQP4ex (1:2000 ...
-
bioRxiv - Immunology 2024Quote: ... The binding of VHHs was next followed by a 30 min incubation at 4 °C with an anti-FLAG-iF647 antibody (A01811, Genscript, Piscataway, NJ, USA), diluted 1:500 ...
-
bioRxiv - Evolutionary Biology 2021Quote: BtKY72 RBD construct (BtKY72 S residues 318-520) was synthesized by GenScript into a CMVR plasmid with a N-terminal mu-phosphatase signal peptide and a C-terminal hexa-histidine tag (-HHHHHHHH ...
-
bioRxiv - Immunology 2022Quote: ... were coated with S-2P protein 1 μg/mL (Genscript, Piscataway, NJ), RBD protein 1 μg/mL (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... The S variant constructs were cloned into the pcDNA3.1 vector by GenScript Biotech (Piscataway ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we transformed 4 μg of a dsDNA cassette carrying the full-length adk.d6 variant with 400 bp flanking genomic homology (constructed by GenScript USA Inc., Supplementary Table 4). Cells were grown in the presence of 200 μM bipA in 2×YT media throughout the entire procedure ...
-
bioRxiv - Neuroscience 2024Quote: ... A total of 20–50 μg of the protein lysate was loaded onto a polyacrylamide gel (SurePAGE™, Bis-Tris, 10×8, 4%–12%, GenScript, Piscataway, NJ, USA), and the separated proteins were transferred to a 0.45 µm polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... The plasmid encoding for SARS-CoV-2 S RBD was synthesized commercially (Genscript). The RBD sequence (encoding for residues 319-541 ...
-
bioRxiv - Microbiology 2023Quote: Full-length SARS-CoV-2 S gene (GenBank: NC_045512.2) was synthesized by Genscript. as human codon-optimized cDNAs ...
-
bioRxiv - Plant Biology 2024Quote: ... the last 1969 bp of SUF4’s disordered region was synthesized (GenScript, USA) with base pair substitutions that replaced the last 5 phenylalanine and lysine residues with serines ...
-
bioRxiv - Plant Biology 2024Quote: ... the last 1969 bp of SUF4’s disordered region was synthesized (GenScript, USA) with base pair substitutions that replaced all 30 alanine residues with isoleucine residues ...
-
bioRxiv - Plant Biology 2024Quote: ... the last 1969 bp of SUF4’s disordered region was synthesized (GenScript, USA) with base pair substitutions that replaced 12 of the 14 phenylalanine and lysine residues with serines ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting the c-MYC stop codon and 3’ end of its 3’UTR (300pmol, supplementary table 3) and pUC57 or pUC57-Mini donor plasmid (1000ng; GenScript Gene Sythesis) containing recombinant sequences for dGFP ...
-
bioRxiv - Plant Biology 2024Quote: ... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were stimulated with synthetic SARS-CoV-2 S peptides pool (Genscript, Cat# RP30020) at the concentration of 2 μg/mL for 12 h and then incubated with 5 μg/mL Brefeldin A (MCE ...
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Microbiology 2024Quote: ... the codon-optimised SADS-S (GenBank AVM80475.1) was ordered as a synthetic gene (GenScript) and cloned into a plasmid encoding the Indiana serotype VSV antigenome replacing the VSV glycoprotein gene ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid encoding human CB2 with three amino-terminal HA-tags was custom-synthesized by GenScript (Rijswijk, Netherlands). The plasmids encoding human C5a1 ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Microbiology 2020Quote: Human codon-optimized cDNA encoding SARS-CoV-2 S glycoprotein (NC_045512) was synthesized by GenScript and cloned into eukaryotic cell expression vector pcDNA 3.1 between the BamHI and XhoI sites ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Genetics 2023Quote: ... The PER2(527-818 S/T-A)-EGFP mutant vector was partially synthesized by Genscript before subcloned into the PER2-EGFP lentiviral vector.
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Genetics 2021Quote: ... Flag-SARS-CoV-B.1.351-S were all obtained from GenScript (Cloned into pcDNA 3.1 vector). Flag-SARS-CoV-2-S1493-685 was made in GenScript.
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Biophysics 2023Quote: The plasmid harboring wild-type Tsa1 (pET19b-Tsa1) was originally obtained with an amino-terminal deca-histidine-tag in a codon-optimized manner from GenScript (kind gift from P.O ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Immunology 2022Quote: ... The SARS-CoV-2 S ‘2P’ ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Biochemistry 2021Quote: ... a SARS-CoV-2 S gene encoding residues 1-1138 (WuhanHu-1; GenBank: MN908947.3) was ordered (Genscript) and cloned into a pPPI4 plasmid containing a T4 trimerization domain followed by a hexahistidine tag by PstI-BamHI digestion and ligation ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 S glycoprotein ectodomain (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) were cloned into pcDNA3.1+ plasmid by GenScript with the host N-terminal signal peptide sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... where the cysteine at position 29 was replaced by aspartic acid (Genscript). The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene) ...
-
bioRxiv - Genetics 2020Quote: Primary anti-rabbit antibody against SYCE1 amino-terminal region (i.e. capable of detecting WT SYCE1 and its putative truncated form) was developed at GenScript (GenScript USA Inc.), using peptides ATRPQPLGMEPEGSC and CPEGARGQYGSTQKI from the amino-terminal region of the protein ...
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Immunology 2020Quote: ... 2.5×106 splenocytes were stimulated with S or N peptide libraries (GenScript, 15mers with 11aa overlap, 1μg/ml), 0.1% DMSO ...
-
bioRxiv - Immunology 2023Quote: ... were coated with 1 μg/mL (for IgG) or 5 μg/mL (for IgA) S-2P protein (GenScript), corresponding to the spike protein of the Wuhan-Hu-1 virus stabilized with 2 proline mutations ...
-
bioRxiv - Biochemistry 2022Quote: ... and SARS-CoV-2 Omicron Strain S gene Human codon_pcDNA3.1(+) expressing the spike protein of the Omicron variant (GenScript# MC_0101274) were used as indicated.