Labshake search
Citations for GenScript :
301 - 350 of 457 citations for Rat ZFP90 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... We also designed the piggyBac vector containing tetR-3xFlag-HA and obtained the plasmid synthesized by GenScript. We transfected the plasmids with Super PiggyBac Transposase Expression Vector (System Biosciences ...
-
bioRxiv - Bioengineering 2020Quote: ... The EQCi plasmids for multiplex gene repression (harboring multiple sgRNA cassettes) were constructed by GenScript (Nanjing, China).
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Microbiology 2021Quote: ... GenBank accession no. NC_004718.3) and WIV1-CoV spike (GenBank accession no. KC881007.1) expression plasmids were synthesized by Genscript and codon-optimized for human expression ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding the YpCntL protein was cloned in a pET-TEV plasmid (synthetic DNA from GenScript). After transformation ...
-
bioRxiv - Biophysics 2022Quote: ... and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues, purchased form GenScript, Piscataway, NJ) and enNTS1 (containing the full set of 10 methionine residues ...
-
bioRxiv - Cell Biology 2022Quote: ... The gRNA: ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu/) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transform into competent cell (Trelief 5a ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Biophysics 2023Quote: The plasmid DNA encoding the different A-IDP sequences in pQE80L cloning vectors was purchased from Genscript Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Cell Biology 2023Quote: The pcDNA3.1-NR2A (catalog #: OHu24642D, NM_000833, human) and the pcDNA3.1-NR1 (catalog #: OHu22255D, NM_007327, human) plasmids were purchased from GenScript. The pcDNA3.1-BiP plasmid was provided by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... All transfections were performed using full-length Rhinolophus ACE2 placed into a HDM plasmid (synthesized by GenScript). Transfection of ACE2 alleles into HEK293T cells was performed using 0.2 µg DNA and 0.15 µL Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... to the N terminus of the DNase1L3 protein coding region and deleting the C-terminal DYK sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript), followed by insertion into the pmEGFP-N1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the C-terminal DYK sequence of the DNase1L3 protein coding sequence from the DNase1L3_OHu20141D_pcDNA3.1+/C-(K)-DYK plasmid (Genscript). The obtained sequence was then inserted into the pmEGFP-N1 vector to construct DNase1L3ΔNT-EGFP ...
-
bioRxiv - Microbiology 2023Quote: Plasmids containing partial CVB5 Faulkner (CVB5F) genome (Accession Number: AF114383) in a pUC57 vector were purchased (GenScript) and were cloned by Gibson Assembly55 using Gibson Assembly Mastermix (NEB ...
-
bioRxiv - Immunology 2024Quote: ... A plasmid encoding full length G12V-TCR in the format TCRα-T2A-TCRβ was synthesized by Genscript and cloned into pcDNA3.1 ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 S glycoprotein ectodomain (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) were cloned into pcDNA3.1+ plasmid by GenScript with the host N-terminal signal peptide sequence ...
-
bioRxiv - Biochemistry 2024Quote: The PDCoVIL121_2014 RBD (Genbank KJ481931.1) and SD2018/300 (Genbank KJ481931.1) spanning residues 303-415 were cloned into pcDNA3.1+ plasmid by GenScript with an N-terminal mu-phosphatase signal peptide sequence and C-terminal short linker GSG ...
-
bioRxiv - Immunology 2022Quote: ... each T150 flasks was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg of pLAIΔEnv GFP or 2.5 μg packaging plasmid (p8.91 ...
-
bioRxiv - Microbiology 2020Quote: The fusion construct comEC-Twin strep tag (plasmid pED2385) was generated from a synthesized fragment purchased from Genscript USA that contained two strep tag II sequences ...
-
bioRxiv - Microbiology 2020Quote: ... each T150 flask was transfected with 2.5 μg of vesicular stomatitis virus-G glycoprotein encoding plasmid (pMDG) (Genscript), 2.5 μg of packaging plasmid ...
-
bioRxiv - Microbiology 2021Quote: Plasmid constructs to produce recombinant proteins were made with a combination of synthesized DNA fragments (GenScript Biotech, Netherlands) and PCR amplicons using extracted culture gDNA as a template ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The plasmid encoding human FPR2 with an N-terminal SNAP-tag was obtained from Genscript (Piscataway, NJ, USA); it was constructed by replacing GLP1R in the previously described pcDNA3.1(+)-Flag-SNAP-GLP1R plasmid [26] with human FPR2 ...
-
bioRxiv - Immunology 2021Quote: ... Antibody VH or VL sequences were cloned into plasmids containing an IgG1 or relevant light chain backbone (Genscript) and used to transfect Expi293 cells (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... fragment 2 was generated by amplification of the kh recoded rescue fragment from a plasmid synthesized by GenScript Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-Fyve is generated by insertion of synthesized SARA1 Fyve domain into pCDNA3.1+N-EGFP plasmid from Genscript as described 40 ...
-
bioRxiv - Biophysics 2022Quote: ... Hel308 used in this study is from Thermococcus gammatolerans (accession number WP_015858487.1) and was cloned into the pET-28b(+) vector plasmid at Ndel/NotI sites by Genscript. Ion current data was acquired at 50 kHz sampling frequency using an Axopatch 200B patch clamp amplifier and filtered with 10 kHz 4-pole Bessel filter ...
-
bioRxiv - Microbiology 2022Quote: ... plantarum strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript, Piscataway, NJ) to express RecE/T and made electrocompetent ...
-
bioRxiv - Neuroscience 2022Quote: Artificial promoter constructs were synthesized and subcloned into an AAV vector backbone plasmid by a commercial supplier (Genscript), placed upstream of GFP for histology and gene expression experiments ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid encoding human CB2 with three amino-terminal HA-tags was custom-synthesized by GenScript (Rijswijk, Netherlands). The plasmids encoding human C5a1 ...
-
bioRxiv - Microbiology 2023Quote: ... For LAI WT each flask was transfected with 2.5 μg of VSV-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 μg pLAIΔEnvGFP (Suppl ...
-
bioRxiv - Cell Biology 2023Quote: ... The pGEX-6P-1-GST-OSBP(377-807) and pET28(+)-ORP2(49-480) plasmids were purchased from Genscript. The pET22b_His6_STARD1(66-284 ...
-
bioRxiv - Cell Biology 2023Quote: All plasmids constructed here are using the pcDNA 3.1 backbone (unless otherwise indicated) and were produced by GenScript. See Supplementary Table 4 for details of reagents.
-
bioRxiv - Immunology 2023Quote: Antibody heavy chain and light chain genes were synthesized and cloned into plasmids containing the CMV promoter (GenScript). Final heavy and light chain plasmids were amplified ...
-
bioRxiv - Immunology 2023Quote: ... Antibody VH or VL sequences were cloned into plasmids containing an IgG1 or relevant light chain backbone (GenScript) and transfected into Expi293 cells (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... FYNB (NM002037.5) flanked by two gateway sites have been synthesized and cloned in PUC57 plasmid (GenScript, Hong Kong). These two clones were individually transferred by Gateway recombinational cloning into pDONR207 vector ...
-
bioRxiv - Biochemistry 2024Quote: The APN ectodomain from galline (Genbank ACZ95799.1) and human residues 66-967 was cloned into pcDNA3.1+ plasmid by GenScript with an N-terminal mu-phosphatase signal peptide sequence and C-terminal short linker GGS ...
-
bioRxiv - Molecular Biology 2021Quote: VLPs were produced by transfecting T150 flasks of HEK293T cells with 8μg of vesicular stomatitis virus-G glycoprotein (VSV-G) expressing plasmid pMDG (Genscript) pMDG ...
-
bioRxiv - Neuroscience 2019Quote: ... The GtACR1-EYFP fragment from the p7-GtCAR1 plasmid was swapped in using CloneEZ® PCR Cloning Kit (GenScript) for the myr::GFP fragment in pJFRC177 and the sequence was verified (GenScript) ...
-
bioRxiv - Bioengineering 2019Quote: ... The anti-DENV scFv was then subcloned into the final vector from a gene-synthesized plasmid (GenScript, Piscataway, NJ) using PmeI and PacI sites and traditional ligation cloning ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of the codon-optimized NF-κB sequence of Capsaspora was synthesized in a pUC57 plasmid by GenScript and was then subcloned into pcDNA-FLAG ...
-
bioRxiv - Microbiology 2019Quote: ... For HIV-1 GFP/Luc each flask was transfected with 2.5 µg of vesicular stomatitis virus-G glycoprotein expressing plasmid pMDG (Genscript) and 6.25 µg pLAIΔEnv GFP/Luc ...
-
bioRxiv - Biochemistry 2022Quote: The genes of the human AC isoforms 1 – 9 cloned into the expression plasmid pcDNA3.1+/C-(K)-DYK were purchased from GenScript and contained a C-terminal flag-tag ...
-
bioRxiv - Molecular Biology 2019Quote: ... The TSEN34 (Y247A, H255A, K286A) and TSEN2 (Y369A, H377A, K416A) catalytic mutant co-expression plasmid was generated by Genscript. Please refer to Table S1 for a list of all expression plasmids used in this study ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid containing the sequence corresponding to the amplified cDNA was purchased from GenScript (pUC57-2019-nCoV-PC:E; MC_0101078) and serially diluted (294 to 2.94×109 genes copies/µl ...
-
bioRxiv - Microbiology 2022Quote: ... This synthetic DNA was cloned into the DIs vector plasmid pSMART-DIs-L3-GPTF (purchased from GenScript, Nanjing, China), which harbors the Escherichia coli gpt gene (encoding xanthine-guanine phosphoribosyltransferase ...
-
bioRxiv - Synthetic Biology 2021Quote: Coding sequences of all tested IspG proteins were ordered codon optimized and cloned in a pET28a(+) plasmid by Genscript. A Tobacco etch virus (TEV ...