Labshake search
Citations for GenScript :
301 - 350 of 866 citations for Rabbit Anti Human IgG gamma chain Alexa Fluor 350 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding human HA-ASC and NLRP3-GFP were obtained from GenScript. Flag-NLRP3 or NLRP3-GFP Cys to Ser (CS ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Microbiology 2020Quote: Custom rabbit polyclonal antibodies (GenScript, Nanjing, China) raised against tryptic peptides of Mtb EsxN (AQAASLEAEHQAIVR ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Immunology 2022Quote: ... or rabbit (GenScript, A00098, 1:2,000 diluted) IgG was added and then developed with 3,3’,5,5’ -tetramethylbenzidine (TMB ...
-
bioRxiv - Molecular Biology 2022Quote: Rabbit polyclonal antibodies were generated by Genscript using the following peptides where additional single Cysteine residues for the cross-linking purpose are indicated in lowercase ...
-
bioRxiv - Cell Biology 2024Quote: ... occludin and GFP (#A01388, rabbit polyclonal, GenScript). GAPDH (#AB0060 ...
-
bioRxiv - Microbiology 2023Quote: ... The immunization of rabbits and affinity purification of p239-specific polyclonal antibody from immunized rabbits were conducted by Genscript Co ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes from Pmel were isolated and culture with 1µM human gp100 (hgp100) (Genscript) and 30 IU/mL recombinant human IL-2 (PeproTech Inc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... hTRPV5 E288DF292LS298T (IS-1) and human TRPV6 (hTRPV6) WT] were obtained from GenScript Corporation (Nanjing ...
-
bioRxiv - Biochemistry 2021Quote: The human Sgk3 gene was codon optimized for expression in insect cells (Genscript) and fused to the C-terminus of His10/StrepII-tagged eGFP (A206K monomeric variant ...
-
bioRxiv - Immunology 2021Quote: ... the variable genes were optimized for human cell expression and synthesized by GenScript. VH and VL were inserted separately into plasmids (gWiz or pcDNA3.4 ...
-
bioRxiv - Biophysics 2023Quote: ... human/mouse codon-optimized genes coding for the identified ChRs were ordered (GenScript, Piscataway ...
-
bioRxiv - Biophysics 2023Quote: ... DNA human WNK3 (118-409) was subcloned into a pET29b vector by Genscript Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... a plasmid with the human NSMCE2 cDNA was purchased from GenScript (cat # Ohu31586D). The NSMCE2 coding sequence was PCR-amplified to add a Kozak consensus sequence for efficient initiation of translation and flanking KpnI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids expressing human KLF family proteins were purchased from Genscript (Piscataway, NJ) or OriGene (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: The human abhd14b gene22 was synthesized as a codon-optimized construct (from Genscript) for expression in E ...
-
bioRxiv - Cell Biology 2024Quote: ... the codon-optimized gene containing full-length human SNX27 was synthesized by GenScript® and cloned into pET28a vector as described previously (30) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2011) or fluorescein Piccolo-peptides (fluor-IEDEEKPVDLTAGRRA) were synthesized and purified (>90% purity) by GenScript. Peptides were solubilized and frozen as a stock solution of 20 mM in water and diluted to a final concentration of 10 µM.
-
bioRxiv - Cancer Biology 2019Quote: ... The sonicated DNA-Protein complexes were immunoprecipitated with the following antibodies: control IgG (A01008, GenScript), anti-TFAP2C (sc-12762 ...
-
bioRxiv - Cell Biology 2019Quote: ... Rabbit polyclonal antibodies against PfAlba3 resulting from immunizations of rabbits with the KLH-conjugate peptide IGKRMFTGNEEKNP were obtained from GenScript Corporation [65] ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blotted with rabbit α-Strep (GenScript) at 1:1000 in TBST + 3% BSA.
-
bioRxiv - Developmental Biology 2022Quote: To generate a custom rabbit polyclonal antiserum (GenScript), a poly-histidine tagged DUXBL fragment (aminoacids 193-350 ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit polyclonal β-catenin(A01211-40; Genscript, China), rabbit polyclonal YAP1(A1002 ...
-
bioRxiv - Molecular Biology 2019Quote: The human AQP7 gene (Uniprot ID O14520) was codon-optimized and synthesized from GenScript, China ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Cancer Biology 2022Quote: The cloning service of recombinant human HK1b and HK1c isoforms was performed by GenScript Inc (Piscataway ...
-
bioRxiv - Biochemistry 2021Quote: ... codon optimized human DHFR was produced as a 6His-SUMO1 fusion from pET28a (Genscript).
-
bioRxiv - Immunology 2021Quote: ... Media supplemented with 10 ng/mL of recombinant human VEGF (GenScript, Piscataway, NJ, U.S.) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant IL-2 (10 U/well) and with or without SIINFEKL peptide (Genscript) at 0.2ug/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biophysics 2022Quote: Full-length human 2’-5’-oligoadenylate synthase 1 (OAS1) has been purchased from Genscript and cloned in the pRSF-Duet1 vector ...
-
bioRxiv - Biophysics 2022Quote: The full length human PARP1 cDNA cloned in pET28-a(+) was purchased from GenScript, USA ...
-
bioRxiv - Biochemistry 2022Quote: A codon-optimized open reading frame for Human DSS1 (DSS1) was synthesized (GenScript Inc.) with a SUMO protease cleavable N-terminal MVKIH-Strep-6x-HIS-SUMO tag ...
-
bioRxiv - Immunology 2022Quote: ... the four genes for each multispecific antibody were synthesized using human preferred codons (GenScript) and cloned into eukaryotic expression vectors ...
-
bioRxiv - Neuroscience 2023Quote: Custom human TauB and TauE plasmids were created on a pET29b backbone by GenScript on a fee-for-service basis ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with the recombinant plasmid carrying the human TDP1 gene (GenScript, OHU22350D) using PEI transfection reagent as previously described (Popovic et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3.1-C-FLAG containing human ATP6V1H transcript variant 1 (NM_015941.4) was purchased commercially (GenScript). pcDNA3.1-ATP6V1H(1-351)-FLAG ...
-
bioRxiv - Biophysics 2023Quote: The γ1 ORF (human ortholog LRRC26) used in this study was obtained from Genscript database and tagged on the C-terminus with 3C protease ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B (OHu30422) and PTPRF (OHu02063) plasmid DNAs were purchased from GenScript.
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 open reading frame and mutant Mint1(D269A/I270A) were obtained from Genscript and cloned into the pcDNA3.1-N-eGFP ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Immunology 2022Quote: ... cell culture media was clarified by centrifugation and the IgG captured using Protein G resin (Genscript). The IgG were eluted from the Protein G resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitations were performed using 0.5μg IgG or RBM10 antibody and protein A magnetic beads (GenScript #L00273) incubated with 2mg lysate overnight at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Cell Biology 2023Quote: Rabbit pAb were made (GenScript Biotech, Piscataway, NJ, USA) against two regions of CABS1 (Fig 1) ...
-
bioRxiv - Immunology 2022Quote: Both Ixodes IRE1α and TRAF2 were codon optimized for expression in human cell lines (GenScript). Primers listed in Supplemental Table 1 were used to amplify full length I ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...