Labshake search
Citations for GenScript :
301 - 350 of 581 citations for QuantiChrom Protein Creatinine Ratio Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... ToxinSensor™ Single Test Kit (GenScript) was applied to verify that the endotoxin levels of the nanoparticle sample were below 50 EU/kg per dose.
-
bioRxiv - Neuroscience 2021Quote: ... using a GenBuilder cloning kit (GenScript). pCS2HA-NPHP1 and pCS2HA-NPHP1 Δ(49-110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a GenBuilder Cloning kit (GenScript). Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT ...
-
bioRxiv - Biochemistry 2021Quote: ... The H4 substrate peptide used in the assay corresponds to the first 19 residues of human H4 (NH2-SGRGKGGKGLGKGGAKRHR-COOH; GenScript). In the assay ...
-
bioRxiv - Biochemistry 2022Quote: The N-terminal peptides of ParBpSM (residues 1-27) and ParBP1 (residues 1-30) used in the ATPase assays were synthesized by GenScript. The sequence of ParBpSM1-27 and its variant ParBpSM1-27 K10A were NH2-MIVGNLGAQKAKRNDTPISAKKDIMGD-CO2H (≥97 % purity ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Mpro inhibition assay was performed using the FRET-based fluorescent peptide substrate DABCYL-KTSAVLQ↓SGFRKM-E(EDANS)-NH2 (purchased from Genscript). The assay was standardized with enzyme concentration of 140 nM and 30 µM of fluorescent substrate in Mpro assay buffer containing (20 mM Tris pH 7.3 ...
-
bioRxiv - Microbiology 2021Quote: ... a panel of gH/gL and EphA2 variants to be tested in biophysical assays was ordered as synthetic genes (GenScript) cloned in pcDNA3.1 (+ ...
-
bioRxiv - Cell Biology 2023Quote: All peptides used for binding assays (Data S1) were synthesized with a N-terminal 5-carboxyfluorescien (5-FAM) at >85% purity (GenScript); peptides used for competition studies did not have 5-FAM ...
-
bioRxiv - Microbiology 2023Quote: ... Total protein was quantified using a BCA assay and 50 μg of each sample was prepared for loading onto 12% precast PAGE gels (GenScript). Wet transfers were performed onto 0.45 uM pore-sized PVDF membranes (Immobilon) ...
-
bioRxiv - Biophysics 2022Quote: The fluorescence-based binding assay employed chemically synthesized unlabeled RNA constructs (wt and mutants) prepared in-house and a peptide mimic (Genscript) of the Tat RNA binding domain N-AAARKKRRQRRR-C containing the arginine rich motif (ARM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were next incubated under constant agitation with 10% (v/v) Protein-A-Sepharose beads (Genscript) for a further 2 h at 4°C before recovery by centrifugation at 13,000 g for 1 min ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Cell Biology 2020Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto Immobilon PVDF membranes (Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... The experiments were performed by direct immobilization of the recombinant IL6 protein (Cat. No. Z03034, Genscript), on a CM5 biosensor chip surface (Cytiva ...
-
bioRxiv - Biophysics 2022Quote: Genes encoding all NS1 EDs and p85β proteins were prepared by gene-synthesis service from Genscript: 1918 NS1 (residues 80 to 205) ...
-
bioRxiv - Immunology 2020Quote: ... cell culture media were clarified by centrifugation and the IgG captured using Protein G resin (Genscript). IgG were eluted from the resin using 100 mM glycine pH 3.0 ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... Coomassie brilliant blue staining for SDS-PAGE were performed using eStain L1 Protein Staining machine (Genscript). Gels for western blot were transferred onto the nitrocellulose membrane and reacted with COVID-19-convalescent serum (1:500 diluted) ...
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Neuroscience 2021Quote: ... and a FLAG-HA tag in-frame with the sORF protein sequence was synthesized by Genscript and cloned into an FUGW overexpression vector (Addgene #14883) ...
-
bioRxiv - Cancer Biology 2021Quote: ... protein – NP_001058.2) cloned into pcDNA3.1+/C-(K)-DYK vector (Clone ID OHu21029D) was purchased from Genscript. The cDNAs were cloned into a bacterial expression vector ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Hdp1opt and Hdp1opt L27Q proteins used for the in vitro experiments were synthesized by GenScript and resuspended in water for a stock concentration of 1 mg/ml.
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2020Quote: Templates for the expression of proteins UF1 to UF6 were prepared by gene synthesis (GenScript, USA). Before synthesis ...
-
bioRxiv - Biochemistry 2021Quote: ... Seven µg of total protein were loaded on an SDS-PAGE gel (GenScript, New Jersey, USA), and then transferred to a PVDF membrane as previously described [42] ...
-
bioRxiv - Biochemistry 2021Quote: ... The wild-type protein and the mutant K96A cloned in pET28a vector were ordered from GenScript. The N-terminally truncated constructs were cloned by amplifying the sequence from the original vector and subcloning into BsaI-cleaved plasmid pNIC28_Bsa4 by SLiCE cloning (83) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatants were incubated with 30 µl of protein A/G-coated magnetic beads (Genscript L00277) to remove the nonspecifically bound proteins for 1 hour at 4 °C with agitation ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Biophysics 2022Quote: ... The target protein complexes were eluted twice with 500 μg/ml 3× DYKDDDDK peptide (RP21087, GenScript) dissolved in the wash buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... transferred to nitrocellulose membrane and the protein tags were detected by rabbit anti-BAP antibody (Genscript) and rat anti-HA antibody (Roche) ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Plant Biology 2022Quote: ... His-FmASP protein was detected by immunoblotting with using a mouse anti-His antibody (GenScript, A00186). The immunoblotting band signals were visualized by enhanced enhanced chemiluminescence (ECL ...
-
bioRxiv - Molecular Biology 2022Quote: The α2 portion of the human α2δ1 protein (NCBI reference sequence NP_00713.2) was produced by GenScript Protein Expression and Purification Services (GenScript Corp ...
-
bioRxiv - Microbiology 2023Quote: ... and the size of bands was indicated by broad multi-color pre-stained protein standard (GenScript). Edman sequencing was performed on a Shimadzu PPSQ-53A at the Iowa State University Protein Facility ...
-
bioRxiv - Cell Biology 2022Quote: M1 ubiquitinated proteins were enriched using GST-tagged UBAN-coupled Glutathione MagBeads (Genscript, Piscataway NJ, SA), as described previously 116 ...
-
bioRxiv - Immunology 2022Quote: ... cell culture media was clarified by centrifugation and the IgG captured using Protein G resin (Genscript). The IgG were eluted from the Protein G resin using 100 mM glycine pH 3.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration from supernatants was measured and ran in 7.5% polyacrylamide gels using MOPS buffer (GenScript) at 130 V ...
-
bioRxiv - Microbiology 2023Quote: ... and visualized by Coomassie blue stain using the eStain protein stain system (GenScript, Piscataway, NJ, USA). Protein identity was verified by Edman degradation by the Protein Chemistry Section of the Research Technologies Branch ...
-
bioRxiv - Genetics 2023Quote: Proteins were separated by SDS-PAGE on 4%-20% MOPS-acrylamide gels (GenScript Express Plus, M42012) and electrophoretically transferred onto PVDF membranes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitations were performed using 0.5μg IgG or RBM10 antibody and protein A magnetic beads (GenScript #L00273) incubated with 2mg lysate overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... were generated via gene synthesis and cloned to produce 6xHis-tagged proteins by Genscript (Piscataway, NJ). Briefly ...
-
bioRxiv - Neuroscience 2024Quote: ... GO grids were first incubated with 3 µL of 250 nM recombinant protein G (Genscript Z02007) in resuspension buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Medium was collected 7 days post-transfection and mAbs were purified using protein A resin (Genscript) affinity chromatography and eluted in PBS (pH 7.4) ...
-
bioRxiv - Immunology 2021Quote: Antibodies inhibiting virus binding to host cell was measured using a commercial RBD-human angiotensin-converting enzyme 2 (hACE2) binding inhibition assay called cPASS™ (GenScript). As per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Biophysics 2021Quote: pET30a vectors encoding proteins WP_032523104.1 and OAD22177.1 (referred to as Pr12 and Pr17, respectively) were prepared by Genscript. Both proteins were produced without signal peptides (residues 1-22 for Pr12 and residues 1-18 for Pr17 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 1 ug of anti-UPF1 or anti-ARS2 antibodies and protein A/G magnetic beads (Genscript). The next day ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human GILT-R37A-GAA protein was produced in HD Chinese hamster ovary cells and purified (Genscript). Cell culture supernatant was centrifuged ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant proteins were subjected to SDS-PAGE followed by immunoblotting using anti-HAT-tag antibody (GenScript) and HRP-conjugated anti-rabbit IgG (Jackson ImmunoResearch) ...