Labshake search
Citations for GenScript :
301 - 350 of 836 citations for Propane 1 2 Diyl Diacetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... RGD-containing peptides derived from SARS-CoV-2 (ADSFVIRGDEVRQIAPGQTG) and KGD-containing peptides derived from SARS-CoV (ADSFVVKGDDVRQIAPGQTG) were produced by Genscript. Integrin-blocking (GRGDSP ...
-
Sterilizing immunity against SARS-CoV-2 in hamsters conferred by a novel recombinant subunit vaccinebioRxiv - Microbiology 2020Quote: ... cells were incubated with pooled peptides of SARS-CoV-2 spike (15-mer peptides with 11 amino acids overlap, cover the entire spike protein, Genscript) and cultured for 20 hours ...
-
bioRxiv - Pathology 2021Quote: ... lung or PBMCs immunized with 1×106 PFU of vaccine were plated into each well and stimulated for 20 h with pooled peptides of RBD of wild type SARS-CoV-2 or variants (15-mer peptide with 11 amino acids overlap, cover the spike, Genscript). The spots were developed based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 843 RUs of SARS-CoV-2 RBD/SD1 fused to human Fc (RBD/SD1-Fc) and 972 RUs of EGFR (Genscript, Piscataway ...
-
bioRxiv - Immunology 2021Quote: VSV pseudovirus harboring BtKY72 K493Y/T498W S (mutants defined based on SARS-CoV-2 numbering) with a native signal peptide and C-terminal 21 residue deletion synthesized by GenScript were prepared as previously described (28) ...
-
bioRxiv - Immunology 2022Quote: For immunoprecipitation, 10×106 human peripheral blood monocytes cells were treated with SARS-CoV-2 Spike protein (RBD, His Tag) (GenScript) 100 ng/ml for 2 hours ...
-
bioRxiv - Immunology 2022Quote: ... OLP peptide pools of 15mers with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD (R319-S591, GenScript). Sequences that contained VOC mutations were exchangeable with the corresponding mutated peptides due to a modular OLP pool design.
-
bioRxiv - Immunology 2022Quote: The variants of concern of SARS-CoV-2 spike protein genes were optimized using mammalian codon and synthesized by Genscript, then cloned into pcDNA3.1(+ ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SARS CoV-2 Mpro and PLpro expression plasmids pcDNA3.1 SARS2 Mpro and pcDNA3.1 SARS2 PLpro was ordered from Genscript (Piscataway NJ) with codon optimization.
-
bioRxiv - Microbiology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using an in-house SARS-CoV-2 nucleocapsid protein (U864YFA140-4/CB2093) rabbit antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were individually synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg each peptide/ml and 8-12 peptides were mixed to create 75 different semi-pools so that the responsible epitopes can be determined from the reactivities of horizontal and vertical pools ...
-
bioRxiv - Immunology 2021Quote: Codon-optimized cDNA encoding the SARS-CoV-2 S1 domain fused to the C-terminal portion of the VSV glycoprotein was obtained from Genscript. The cDNA was cloned into the XhoI and NheI sites of a modified recombinant VSV vector containing an additional transcription start stop signal between the G and L genes (Wirblich et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... ATAD1 was diluted in 2-fold dilution series and incubated with 100 nM fluorescently-labeled peptide (P13: 5-FAM-FSRLYQLRIR, purchased from Genscript) for 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... following published Current Protocols in Neuroscience.43 Plasmids for SARS-CoV-2 variants were synthesized using the prototype sequence (GenScript MC_0101081 ...
-
bioRxiv - Immunology 2021Quote: ... with a C-terminal 8XHis-tag was sub-cloned in pCMV as previously described (McCallum et al., 2020).The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Biochemistry 2021Quote: ... To elute the OST complex the beads were incubated for 2 hrs at 4 °C with purification buffer enriched with 0.5 mg/mL 1D4 peptide (GenScript Corp.). The flow-through was collected in a 100 kDa cutoff filter column (Amicon Centrifugal Filter Device) ...
-
bioRxiv - Immunology 2020Quote: A full-length nucleocapsid (N) phosphoprotein nucleotide sequence (1293 base-pairs) of the SARS-CoV-2 virus was optimized and synthesized (Genscript). The synthesized sequence was cloned into a PET-30a(+ ...
-
bioRxiv - Immunology 2021Quote: Blocking of the RBD-ACE2 interaction by the mouse sera was assessed using a SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript) (Tan et al ...
-
bioRxiv - Immunology 2020Quote: The three epigraph HA and wildtype A/swine/Texas/4199-2/1998 HA immunogens were codon-optimized for swine gene expression and synthesized by GenScript. These genes were cloned into an Adenovirus type 5 replication-defective E1/E3 deleted vector using the Ad-Easy Adenoviral Vector System (Agilent) ...
-
bioRxiv - Immunology 2020Quote: The human codon optimized cDNA of the SARS-CoV-2 spike protein (MC_0101081) was purchased from GenScript (Piscataway, NJ, USA). The human ACE2 cDNA was derived from MGC clone 47598 ...
-
bioRxiv - Immunology 2020Quote: ... Peptide pools consisted of 15-mer peptides overlapping by 11 amino acids and spanned the entire SARS-CoV-2 S protein (GenScript). After stimulation ...
-
bioRxiv - Microbiology 2022Quote: ... The N-terminal domain (Delta-like) of the SARS-CoV-2 Delta-Omicron recombinant spike was chemically synthesized as a short fragment (Genscript) and fused by overlapping PCR with the RBD and C-terminal parts of the BA.1 spike ...
-
bioRxiv - Biochemistry 2023Quote: Human Mint1 sequences for bacterial expression were codon optimised and sub-cloned into the pGEX4T-2 plasmid by Genscript (USA). The constructs generated were GST-tagged Mint1(226- 314)(MID) ...
-
bioRxiv - Immunology 2024Quote: Total IgG was from 3 mL human serum from a patient vaccinated against SARS-CoV-2 using protein G agarose resin (Genscript). Protein G resin was washed with PBS and eluted with 0.1M glycine buffer ...
-
bioRxiv - Biophysics 2024Quote: 5X repeat Nck SH3 domain 2 (polySH3) and 5X repeat Abl PRM (polyPRM) codon-optimized genes were purchased from GenScript and cloned into a pMal plasmid to generate fusion proteins with an N-terminal Maltose Binding Protein (MBP ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.25% DMSO) (refer to Fig. 1C) in the presence or absence of SARS-CoV-2 spike protein (5ng/mL; GenScript). Controls were kept in the treatment solution with only DMSO ...
-
bioRxiv - Biochemistry 2023Quote: Remaining samples of sera from corresponding administration routes along with prebleed samples were pooled and passed through a protein A column and the recovered IgGs used in SARS-CoV-2 surrogate virus neutralisation assays (sVNT) 38 using a commercial kit (GenScript).
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were coated with 2 μg/mL of recombinant Karp type-specific antigen 56 (TSA56, generated by Genscript) in PBS and blocked with 1% BSA ...
-
bioRxiv - Microbiology 2023Quote: ... and Omicron BA.5 spike were based on the codon-optimised spike sequence of SARS-CoV-2 and were generated by GenScript Inc ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 sequences (Genbank accession number MN908947) were codon-optimized for Chinese Hamster Ovary (CHO) cells and synthesized by GenScript. Within the construct ...
-
bioRxiv - Immunology 2023Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the fragments ...
-
bioRxiv - Immunology 2023Quote: A commercially available kit to quantify the ability of the three pAbs to neutralize the binding of RBD to ACE-2 was obtained from GenScript, Piscataway NJ (kit #L00847) ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse spleen cells were stimulated with 2 μg/ml S1、S2 peptide pools spanning SARS-CoV-2 spike S1 and S2 respectively (15mers, overlapping by 11aa, GenScript) or equimolar amount of DMSO (negative control ...
-
bioRxiv - Immunology 2024Quote: DNA fragments that encode SARS-CoV-2 variant RBD (Spike 319-541) were codon-optimized for human cell expression and synthesized by Genscript. His-AVI tags were added at the end of the RBD gene fragments ...
-
bioRxiv - Immunology 2024Quote: 15-mer peptides with 11 amino acids overlap that cover the full length of S protein of SARS-CoV-2 were synthesized (GenScript). Peptides were dissolved in DMSO at 12 mg/ml and 12-15 peptides were mixed to create 26 different semi-pools ...
-
bioRxiv - Microbiology 2024Quote: Plasmids encoding full-length or truncated proteins from SARS-COV-2 (clinical isolate Australia/VIC01/2020) tagged at the N-terminus with eGFP were generated by GenScript in pcDNA 3.1-N-eGFP ...
-
bioRxiv - Microbiology 2024Quote: ... Peptide cleavage reporter assays were prepared by combining 1 µL of PsCaspase cell lysates with 2 µL of 100 µM synthetic 7-amino-4-methylcoumarin (AMC)-conjugated peptides (Genscript) and 5 µL of 100 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Plant Biology 2024Quote: MtAPI and MtHAPI1 mCitrine-tagged variants were synthesised with flanking Gateway-compatible attL1/2 sites and cloned into pUC57 by Genscript. The mCitrine CDS was inserted with a short N-terminal linker sequence (linker-mCitrine ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.2 uM of 6xHis-SUMO-UBA and GST/GST-ERC1 FL were incubated with Ni-Charged NTA magnetic resins (GenScript) in the reaction buffer (50mM imidazole ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were coated ON at 4 °C with 2 µg/mL mouse anti-human IgG Fc (Genscript, Piscataway, NJ, USA) in PBS ...
-
bioRxiv - Immunology 2024Quote: ... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
bioRxiv - Biochemistry 2024Quote: ... non-targeting sgRNA (TGCTTTACCGCGTTGGGTAA) or CLYBL targeting sgRNA (exon 2: CATAGAGCACTGCTCTCCGG; exon 3: AGACTTTGACCTGGGCACAA; exon 4: CCATTGCAGTCTCCACAAAG) were purchased from Genscript. Plasmids were transformed into OneShot™ E ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatant from centrifugation at 12000 rpm for 45 min was applied to 2 mL of Anti-DYKDDDDK G1 Affinity Resin (GenScript) which was washed five times by 5 mL of wash buffer I (25 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Expression constructs encoding ERBB4 JM-a CYT-2 point mutants listed in Supplementary Table S1 were created by cloning mutant inserts from pDONR221-vectors (Genscript) into pBABE-puro-gateway retroviral mammalian expression vector (a gift from Matthew Meyerson ...
-
bioRxiv - Bioengineering 2024Quote: ... Modified synthetic sgRNAs (2’-O-methyl-3’phosphorothioate linkage modifications in the first and last three nucleotides) were purchased from Genscript. sgRNA concentration was calculated using the full-length product reporting method ...
-
bioRxiv - Biochemistry 2024Quote: The TRI2-2 and influenza virus minibinders were cloned into pET29b between the NdeI and XhoI restriction sites by Genscript. The TRI2-2 minibinder was cloned with a C-terminal polyhistidine tag and the influenza minibinder was cloned with an N-terminal polyhistidine tag17 ...
-
bioRxiv - Cell Biology 2022Quote: ... GRGDSPC peptide (1% w/v) (Genscript) was added to the solution ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Biophysics 2020Quote: ... MEC-10 and DEGT-1 (GenScript) in the pGEM-HE oocyte expression vector (Liman et al. ...
-
bioRxiv - Microbiology 2021Quote: ... CSP-1 (GenScript, New Jersey, USA), as previously described (36) ...