Labshake search
Citations for GenScript :
301 - 350 of 587 citations for Mouse ATPAF2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Immunology 2023Quote: ... with 200 μg of recombinant mouse IFN-γ alone (Genscript), 250 μg anti-CD115 (clone ASF98 ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 10 nM biotinylated antibody (mouse anti-FLAG, GenScript). Chambers were flushed to remove reagents ...
-
bioRxiv - Plant Biology 2023Quote: ... and Goat- Anti-Mouse IgG [HRP] (1:3000; GenScript, A00160) secondary antibody ...
-
bioRxiv - Immunology 2023Quote: ... plus 10 ng/mL of mouse IL-2 (Z02764, Genscript) in 2 mL complete RPMI1640 medium for 72 h.
-
bioRxiv - Immunology 2019Quote: ... The plasmids with rMIC1-T126A/T220A and rMIC4-K469M were synthesized by GenScript (New Jersey, US) using a pET28a vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The guide RNAs were cloned into the enhanced specificity CRISPR/Cas9 plasmid (eSpCas9-LentiCRISPR, v2, Genscript) (26) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids carrying single and double mutations were generated and sequence-verified by GenScript (Piscataway, NJ, USA). The numbering of the mutants refers to the sequences with the signal peptide included.
-
bioRxiv - Microbiology 2021Quote: Plasmids encoding cDNA for hMPV 130-BV F and hMPV B2 F proteins were synthesized (GenScript) and cloned into the pcDNA3.1+ vector as previously described (29 ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding human codon-optimized spike genes with the desired mutations were purchased (GenScript, Piscataway, NJ). Supernatants containing pseudoviruses were collected 48 h post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid encoding the Spike of theB.1.1.7 variant was codon-optimized and synthesized by Genscript.
-
bioRxiv - Developmental Biology 2019Quote: ... All iOn and control piggyBac vectors were assembled in a pUC57-mini plasmid backbone (Genscript Inc) using a combination of DNA synthesis (Genscript Inc) ...
-
bioRxiv - Bioengineering 2019Quote: ... The plasmid pUC57 containing the flanking sequences of the gene aceA was purchased from GenScript (USA) and further linearized using the primers JL18-1 and JL18-2 ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid from the Baric system which contained the ZIKV E gene was modified by GenScript to include the Y61F ...
-
bioRxiv - Molecular Biology 2020Quote: ... while a plasmid standard from a synthetic construct of the P74 gene of SGHV from GenScript was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Immunology 2021Quote: ... plasmids encoding cDNAs for the heavy and light chain sequences of PhtD3-IgG2a were synthesized (GenScript), and cloned into pCDNA3.1+ ...
-
bioRxiv - Immunology 2022Quote: ... B2 F and hMPV B2F-GCN4 recombinant proteins were synthesized from the plasmids obtained from GenScript cloned into pcDNA3.1+ vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... The uLimch1 and mLimch1 sequences were cloned into the backbone of a pcDNA3.1 plasmid by GenScript. Transfected cells were incubated in antibiotic free DMEM supplemented with 10% FBS for 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... For viruses requiring a packaging plasmid each flask was transfected with 2.5 μg of pMDG (Genscript), 2.5 μg of p8.91 (encoding Gag-Pol ...
-
bioRxiv - Biophysics 2023Quote: ... Glu50Ala (E50A) and Asp94Ala (D94A) mutations were generated in the pcDNA3.1-mGL-picALuc plasmid (GenScript, Singapore). For generating the picSm and picSm-GCN4 fragment expressing plasmids ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids containing the L245A and L245C substitutions in gene 8 were also made by GenScript. The constructs ...
-
bioRxiv - Immunology 2023Quote: ... standard curves were generated using a synthetic plasmid containing a segment of the E-gene (GenScript) and interpolation was performed as described by Feld et al.71 ...
-
bioRxiv - Biochemistry 2023Quote: ... The empty vector control and specific point mutations of this plasmid were also generated by GenScript. Plasmids were transformed with Invitrogen’s One Shot Top10 chemically competent cells ...
-
bioRxiv - Microbiology 2023Quote: Plasmids were either constructed by Gibson assembly17 or synthesized and cloned by Genscript (see Table S2). The vector for all plasmids was pHERD-30T17–19,65 and Genscript cloned the inserts using SacI and SalI ...
-
bioRxiv - Neuroscience 2024Quote: ... and a plasmid encoding human Kv5.1 with a C-terminal GFP tag was generated by Genscript. The Kv5.1BBS construct was generated at Genscript by inserting a bungarotoxin-binding site (GGWRYYESSLLPYPDGG ...
-
bioRxiv - Cell Biology 2024Quote: Wild-type and analog-sensitive Chk2 ORF sequences were cloned in the pGex6p-1 plasmid (Genscript, see plasmid construction section for details ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Immunology 2022Quote: ... 8) TCRβ-CD3εcrosslinking: mouse anti-V5 and rabbit anti-HA (Genscript); 9 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The mouse ASIC1a subunit was synthesized by GenScript (new Jersey, USA) with SacI and BamHI restriction sites flanking the start and stop codons ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Mouse pre-immune serum and antiserum after 3rd immunization (GenScript) was used 1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... Mouse anti-His tag mAb conjugated with horseradish peroxidase (GenScript: A00186) at a 1:8000 dilution was added and incubated for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: pPB-NSP5-SV5-Csy4 and pPB-SV5-Csy4 plasmids were obtained from a GenParts DNA fragment (Genscript) containing NSP5-SV5-Csy4 and SV5-Csy4 and inserted in the pPB-MCS vector (VectorBuilder ...
-
bioRxiv - Cell Biology 2022Quote: The full length WWP2 plasmid (NM_001270454.1) was ordered in pcDNA3.1 with XhoI/XbaI cloning sites (Genscript Biotech). The plasmid was digested and inserted into the XhoI/XbaI sites of the pLV-CMV-IRES-eGFP lentiviral backbone (kindly provided by Prof ...
-
bioRxiv - Genetics 2019Quote: ... We also designed the piggyBac vector containing tetR-3xFlag-HA and obtained the plasmid synthesized by GenScript. We transfected the plasmids with Super PiggyBac Transposase Expression Vector (System Biosciences ...
-
bioRxiv - Bioengineering 2020Quote: ... The EQCi plasmids for multiplex gene repression (harboring multiple sgRNA cassettes) were constructed by GenScript (Nanjing, China).
-
bioRxiv - Biochemistry 2021Quote: The pcDNA3.1(+) plasmid encoding the C-terminally 3xFLAG-tagged MTG1 (UniProt ID Q9BT17) was ordered from GenScript. The inserted sequence was verified using a CMV forward primer at Microsynth ...
-
bioRxiv - Cell Biology 2020Quote: FLAG-tagged (FT)-Tg in pcDNA3.1+/C-(K)-DYK plasmid was purchased from Genscript (Clone ID OHu20241). Site-directed mutagenesis was then performed to engineer FTG2341R ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: The pcDNA3.1(+)-CMV-SARS-CoV-2-S-GFP (pSARS-CoV-2-S) plasmid was purchased from Genscript Co. ...
-
bioRxiv - Microbiology 2021Quote: ... GenBank accession no. NC_004718.3) and WIV1-CoV spike (GenBank accession no. KC881007.1) expression plasmids were synthesized by Genscript and codon-optimized for human expression ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding the YpCntL protein was cloned in a pET-TEV plasmid (synthetic DNA from GenScript). After transformation ...
-
bioRxiv - Biophysics 2022Quote: ... and pDS170 plasmids carrying the parent templates enNTS1ΔM10 (containing no methionine residues, purchased form GenScript, Piscataway, NJ) and enNTS1 (containing the full set of 10 methionine residues ...
-
bioRxiv - Cell Biology 2022Quote: ... The gRNA: ATAGTGCTCGCACTTGCAAC (designed in http://crispr.mit.edu/) was linked into the CRISPR Cas9 Plasmid (Genscript; Nanjing, China) and transform into competent cell (Trelief 5a ...
-
bioRxiv - Microbiology 2022Quote: ... The SARS-CoV-2 N gene was PCR amplified from plasmids pUC57-SARS-CoV-2-N (GenScript) using forward primers with T7 promoter and reverse primers with poly(T)34 sequences ...
-
bioRxiv - Biophysics 2023Quote: The plasmid DNA encoding the different A-IDP sequences in pQE80L cloning vectors was purchased from Genscript Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...